ID: 1152661401

View in Genome Browser
Species Human (GRCh38)
Location 17:81543985-81544007
Sequence GCAGGTATGTCGGCCCGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152661401_1152661410 17 Left 1152661401 17:81543985-81544007 CCCCAGCGGGCCGACATACCTGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1152661410 17:81544025-81544047 ATGGTGCGCCCTGCAAATGTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
1152661401_1152661405 -7 Left 1152661401 17:81543985-81544007 CCCCAGCGGGCCGACATACCTGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1152661405 17:81544001-81544023 TACCTGCATGCGCCCGACAACGG 0: 1
1: 0
2: 0
3: 0
4: 19
1152661401_1152661407 -2 Left 1152661401 17:81543985-81544007 CCCCAGCGGGCCGACATACCTGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1152661407 17:81544006-81544028 GCATGCGCCCGACAACGGCATGG 0: 1
1: 0
2: 0
3: 0
4: 13
1152661401_1152661413 26 Left 1152661401 17:81543985-81544007 CCCCAGCGGGCCGACATACCTGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1152661413 17:81544034-81544056 CCTGCAAATGTCGGCCAGAGAGG 0: 1
1: 0
2: 1
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152661401 Original CRISPR GCAGGTATGTCGGCCCGCTG GGG (reversed) Exonic
906564705 1:46790684-46790706 GAAGGTATGTAGGACCTCTGAGG + Intronic
907165670 1:52408565-52408587 TCAGGTATGTCCGCATGCTGGGG + Exonic
908461274 1:64350379-64350401 GCAGGAATGTCAGGCCTCTGAGG - Intergenic
913485787 1:119331813-119331835 GCAGGTAGGTGGGCCCAGTGTGG + Intergenic
915286913 1:154859004-154859026 GCAGGTATGGTGCCCCCCTGAGG + Intronic
915315481 1:155026341-155026363 GCAGCTATGTCAGCCGGCTGCGG - Exonic
1063662449 10:8043776-8043798 CCAGGTCTGTCTGCCCTCTGGGG - Intergenic
1075644842 10:124090810-124090832 GCAGGCAGGTCGGCCCACAGTGG - Intronic
1076373600 10:129969412-129969434 TCAGGTCCGTCGCCCCGCTGCGG - Intergenic
1096844350 12:54397431-54397453 GCAGCTATGGCGTCCCACTGTGG - Exonic
1097305786 12:58067573-58067595 GCAGGTATTTCAGCCTGCTGGGG - Intergenic
1100822411 12:98443872-98443894 GCATGTATCTCGGCCAGGTGTGG - Intergenic
1102563382 12:113778772-113778794 GCAGGAATGTGAGCCAGCTGAGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114649025 14:24271468-24271490 GCAGGTGGGTCCGCCCGCGGGGG - Exonic
1115610766 14:35046625-35046647 GCAGGTAGGTGGGGCCGCCGAGG + Exonic
1115715021 14:36094024-36094046 GCAGGTGTGTTGGGCTGCTGTGG + Intergenic
1117087588 14:52217818-52217840 GCAGGTGTGACTGCCTGCTGAGG + Intergenic
1132620989 16:868244-868266 GCAGGGATGGGGCCCCGCTGGGG - Intronic
1134130426 16:11645963-11645985 CCAGGTATGTCGGGAGGCTGAGG - Intergenic
1142756722 17:2020912-2020934 GAAGGAAGGGCGGCCCGCTGGGG - Intronic
1152040569 17:77900026-77900048 CCAGGTATCTGGGCCTGCTGAGG - Intergenic
1152661401 17:81543985-81544007 GCAGGTATGTCGGCCCGCTGGGG - Exonic
1165031452 19:33000618-33000640 GCAGGTGTGCAGGCCCGCAGAGG - Intronic
1166118530 19:40670527-40670549 GCAGGCATGGCGGCCCCGTGAGG + Intronic
928904713 2:36356620-36356642 GAAGGTACGGCCGCCCGCTGCGG + Exonic
948301544 2:236911240-236911262 GCACGTGTGTGGCCCCGCTGAGG + Intergenic
1173072836 20:39785993-39786015 GCAGACATGTGGGCCCCCTGAGG + Intergenic
1173210694 20:41029287-41029309 GCAGGGATGGCTGCCCTCTGTGG + Intronic
1174486839 20:50866456-50866478 GCAGGAATGTGGGCCTGCGGTGG + Intronic
1175520890 20:59602274-59602296 ACATGCATGTCGGCCCGGTGTGG + Intronic
1176284452 21:5012171-5012193 GCAGTGATGTGGGCACGCTGGGG - Intergenic
1179451612 21:41472236-41472258 GGAGGGATGTCGGCCCATTGTGG - Intronic
1179872729 21:44251304-44251326 GCAGTGATGTGGGCACGCTGGGG + Intronic
1183134401 22:35872771-35872793 GCCTGTATGTCTGCCCGCTAGGG + Intronic
959583400 3:108004210-108004232 GCTTGTGTGTCTGCCCGCTGGGG - Intergenic
968258111 3:197297766-197297788 GCAGGTGTGGGGGCCCGCGGAGG - Intronic
985218148 4:187674820-187674842 GCAGGTGTGTCTGCACACTGCGG - Intergenic
986017609 5:3771307-3771329 GCAGGAATGTCGGGCCACAGCGG - Intergenic
995238559 5:109858896-109858918 GCAGGTATGACAACCCACTGAGG + Intronic
1001157999 5:169289846-169289868 TCAGGTATGTCTGCATGCTGTGG - Intronic
1001256743 5:170189222-170189244 GCAGGTAGGACGGCCCCCAGAGG - Intergenic
1022142850 7:27508219-27508241 GCAGATATGTCAGCCATCTGGGG - Intergenic
1034355614 7:150448806-150448828 TCAGGGCTCTCGGCCCGCTGGGG + Intergenic
1035332900 7:158107887-158107909 GCAGGTACATGGGCCTGCTGTGG - Intronic
1040787359 8:51181393-51181415 GCAGCTCTGTCTGCCCGCTAGGG - Intergenic
1044262498 8:90143059-90143081 GAAGGTTTGTCTGCCTGCTGAGG + Intergenic
1049472265 8:142781773-142781795 GCAGGGCTGTCGGCCCCCTCTGG + Intergenic
1056522875 9:87416218-87416240 GCAGGAATGTCAGGCCTCTGAGG + Intergenic
1060217143 9:121745228-121745250 CCAGGTATGTGGGCTCACTGTGG + Intronic
1061499555 9:130994060-130994082 GCAGGGAGATTGGCCCGCTGGGG - Intergenic
1061699110 9:132401879-132401901 GCAGGAATCCCGGCCTGCTGTGG - Exonic
1191721208 X:64230401-64230423 ACAGGTCTGTGGGCCCGCAGTGG + Intronic
1192587876 X:72334224-72334246 GCAGTTGAGTCTGCCCGCTGTGG - Intronic
1194351591 X:92828888-92828910 GCAGGAATGTCAGGCCTCTGAGG + Intergenic
1198599406 X:138267796-138267818 GGAGGAATGTCTGGCCGCTGCGG + Intergenic
1200224364 X:154409093-154409115 GCAGGTATGGGAGCCCCCTGGGG - Exonic