ID: 1152661591

View in Genome Browser
Species Human (GRCh38)
Location 17:81544806-81544828
Sequence AGCCCTTTCAGCCCTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152661591_1152661597 12 Left 1152661591 17:81544806-81544828 CCAGCATCAGGGCTGAAAGGGCT 0: 1
1: 0
2: 2
3: 8
4: 147
Right 1152661597 17:81544841-81544863 GCCAAGGTACCCGAGGGCCGAGG 0: 1
1: 0
2: 1
3: 5
4: 86
1152661591_1152661595 5 Left 1152661591 17:81544806-81544828 CCAGCATCAGGGCTGAAAGGGCT 0: 1
1: 0
2: 2
3: 8
4: 147
Right 1152661595 17:81544834-81544856 GAGGGCAGCCAAGGTACCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 121
1152661591_1152661594 -4 Left 1152661591 17:81544806-81544828 CCAGCATCAGGGCTGAAAGGGCT 0: 1
1: 0
2: 2
3: 8
4: 147
Right 1152661594 17:81544825-81544847 GGCTGTGTAGAGGGCAGCCAAGG 0: 1
1: 0
2: 4
3: 39
4: 298
1152661591_1152661596 6 Left 1152661591 17:81544806-81544828 CCAGCATCAGGGCTGAAAGGGCT 0: 1
1: 0
2: 2
3: 8
4: 147
Right 1152661596 17:81544835-81544857 AGGGCAGCCAAGGTACCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152661591 Original CRISPR AGCCCTTTCAGCCCTGATGC TGG (reversed) Intronic
900576198 1:3383655-3383677 AGCCATTTCGGGCCTGGTGCTGG - Intronic
901520364 1:9779169-9779191 AGCCGTTTCAGACCTGATGCTGG - Intronic
901954036 1:12771114-12771136 AGCCTTTTCAGCTCTAAGGCTGG - Intergenic
903183695 1:21618048-21618070 CGCACTCTCAGCCCTGAGGCTGG - Intronic
904339732 1:29826990-29827012 GGCCCTCCCAGCACTGATGCCGG - Intergenic
904404428 1:30276726-30276748 GGCCCTCTCAGCTCTGATGCCGG + Intergenic
904991615 1:34597949-34597971 AACCCTTTGAGCTCTGCTGCTGG - Intergenic
906143925 1:43549063-43549085 AGCCCTTTCAGCACAGCTCCCGG - Intronic
910377361 1:86587084-86587106 TGCCCCTGCAGCCCTGATTCTGG - Intergenic
917629036 1:176875115-176875137 GGCCCTTTCTGCCCTGAGGAAGG + Intronic
917663766 1:177203927-177203949 CGTCCTTAAAGCCCTGATGCTGG + Intronic
920828510 1:209445072-209445094 AGCCCATTCACCCCCAATGCAGG - Intergenic
921599380 1:217090326-217090348 AGCCCCCTCAGCCCGAATGCTGG + Intronic
922963366 1:229666874-229666896 AGCTCTGTCTGCCCTGCTGCAGG - Intergenic
923231849 1:231994181-231994203 TGCACGTTCAGCCCTGGTGCAGG - Intronic
1062927694 10:1329387-1329409 AGCTCTTTCAGACCAGAAGCAGG + Intronic
1070334827 10:75446030-75446052 TGCCCTTTCTCCCCTGCTGCAGG + Intronic
1071049757 10:81432095-81432117 AACCCTTTCAACACTAATGCTGG - Intergenic
1072611337 10:97019310-97019332 AGCCCTTCCAGCCCAGAGGGAGG - Intronic
1072987070 10:100150210-100150232 TGCCCTCTCAGCTCTGAGGCTGG - Exonic
1074421099 10:113309469-113309491 CCCCCTTTCAGTCCTGATTCTGG - Intergenic
1074688073 10:115977995-115978017 AGCCATCTCAGCCCCGAGGCAGG - Intergenic
1077202391 11:1317424-1317446 AGCCCTATCCGCCCTGAAGGTGG + Intergenic
1078350104 11:10586056-10586078 AGCCCTTCCTGCCCTCAGGCTGG + Intronic
1081274182 11:41126617-41126639 AGCCCTTCCAACACTGATTCTGG + Intronic
1084212814 11:67631689-67631711 ATCCCTATCAGCCCGGATGTTGG + Exonic
1089910013 11:122088588-122088610 AGCCCTTCATGCCCTGATCCTGG - Intergenic
1090280597 11:125452868-125452890 AGCCCACTAGGCCCTGATGCTGG - Intronic
1091447892 12:554342-554364 AACCCTTCCAGCCCACATGCAGG - Intronic
1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG + Intronic
1101282362 12:103271455-103271477 AGACCTATCAGCTGTGATGCTGG + Intronic
1102000641 12:109555964-109555986 AGGCATTTCAGCCCTGAAACTGG + Exonic
1102385447 12:112505266-112505288 ATCCCTTCCAGCTCTGCTGCTGG + Intronic
1102456440 12:113073676-113073698 AGCTCTTTCAGCCCTGAGTAGGG + Intronic
1102502340 12:113360987-113361009 AGCCCTTGAGGCTCTGATGCAGG + Intronic
1111409865 13:87860726-87860748 AACACTTTCAACCCTGATCCAGG - Intergenic
1111658854 13:91184282-91184304 AGACTTCTCAGCCCTGATGCTGG - Intergenic
1112609971 13:100946370-100946392 ACCACTCTCAACCCTGATGCTGG + Intergenic
1113371696 13:109731210-109731232 AGCTCCTCCAGCCCTGAAGCAGG - Intergenic
1118453744 14:65927105-65927127 AGCCCTCCCAGCCCTTGTGCTGG - Intergenic
1120410515 14:84148998-84149020 AGCTCTTTGAATCCTGATGCAGG - Intergenic
1120710769 14:87790754-87790776 AGCCCTTCCATCCCTGTTGAAGG - Intergenic
1122711753 14:103663664-103663686 AACCCTTTCACCCCTGTTGAAGG + Intronic
1124094237 15:26633866-26633888 AGTTCTTTCAGCCCTGAAGAAGG - Intronic
1124789743 15:32717332-32717354 GGTTCTTTCAGCCCAGATGCCGG - Intergenic
1125931023 15:43600255-43600277 GGCTCTTTCAGCACTGCTGCGGG - Exonic
1125944187 15:43700071-43700093 GGCTCTTTCAGCACTGCTGCGGG - Intergenic
1129236587 15:74227360-74227382 AGCCCATGCAGCACTAATGCTGG + Intergenic
1129379851 15:75158129-75158151 AGCCCTGGCAGTCCTGATGATGG - Intergenic
1131135832 15:89934292-89934314 AGCCCTTTCAGCCTAGATTGTGG - Intergenic
1131261861 15:90891744-90891766 AGCCCTTTCTGCTCAGACGCTGG - Intronic
1131302020 15:91207963-91207985 TGCCCCTTCTTCCCTGATGCAGG - Intronic
1133225754 16:4339657-4339679 AGCCCCTGCAGGCCTGATCCGGG + Intronic
1136564428 16:31061543-31061565 AGCCCTAGCAGCCCTGCTGGAGG + Exonic
1137293225 16:47066358-47066380 AGCCCTTTCATCTCTTTTGCTGG + Intergenic
1139036233 16:62949968-62949990 AGCTCTTTCAGCCTGGCTGCTGG - Intergenic
1139485701 16:67255540-67255562 AGCCTCTTCTGTCCTGATGCGGG - Intronic
1142698524 17:1646326-1646348 ACCCCGTCCTGCCCTGATGCAGG + Exonic
1143958842 17:10697639-10697661 AGGCCTTTCAGCCCAGGGGCCGG + Exonic
1144161165 17:12559717-12559739 ACCTCTTTCAGTCCTGATACTGG + Intergenic
1148736509 17:49868209-49868231 TGCCCTTTCAGCCAAGAGGCTGG + Intergenic
1151337817 17:73450421-73450443 AATCCTGTCAGCCCTGAAGCTGG - Intronic
1152196957 17:78924031-78924053 AGCCTCTGCAGCCCTGGTGCTGG - Intronic
1152661591 17:81544806-81544828 AGCCCTTTCAGCCCTGATGCTGG - Intronic
1154066290 18:11110405-11110427 AGCCCTGTCAGCCAGAATGCGGG - Intronic
1156481442 18:37439042-37439064 AGCCTCCTCAGTCCTGATGCTGG + Intronic
1157986491 18:52444154-52444176 AGCCCTTCCAGACCTGGTTCAGG - Intronic
1159292479 18:66440238-66440260 AGCTCTCTCAGCCCTGACACTGG - Intergenic
1160399611 18:78600541-78600563 AGACTCTTCAGCCCTGGTGCAGG - Intergenic
1160983801 19:1828298-1828320 GGCCTATTAAGCCCTGATGCCGG - Exonic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1165446458 19:35859532-35859554 ACCCCTTTCAGCCATGATGATGG + Exonic
1166141518 19:40807805-40807827 ACACCTTTCTGTCCTGATGCTGG - Exonic
1168645732 19:58057915-58057937 AGCCTGCTCAGCCCTGATGGTGG - Intergenic
924992372 2:323242-323264 AGCCTTCTGAGCCCTGAGGCAGG + Intergenic
925318484 2:2942700-2942722 CTCCCTTTCAGCCCTGAGACTGG - Intergenic
933298907 2:80521095-80521117 AGCCCTGACAGCCCTTGTGCTGG + Intronic
933635049 2:84699664-84699686 AGGCCTTTCGGTCCCGATGCAGG + Exonic
934564472 2:95330675-95330697 GGCCCTTTCAGCCAGGGTGCCGG + Intronic
934766740 2:96884046-96884068 GGCCCTTTCAGACCCGAGGCTGG + Intronic
937198329 2:120180057-120180079 AGCCCCTCCAGGCCTGGTGCTGG - Intergenic
937899239 2:127005000-127005022 TGCTCTTCCATCCCTGATGCTGG - Intergenic
939599934 2:144175910-144175932 AGCACTTTCAGAGCTGAGGCAGG - Intronic
945492816 2:210476382-210476404 GGCCCTTTGAGCCATGACGCCGG + Exonic
947533259 2:230925908-230925930 AGCCCTCCCAGCCCTGAAGGTGG - Intronic
947762051 2:232610281-232610303 AGCCCTCCCATCCCTGAGGCTGG + Intronic
947811483 2:233006995-233007017 AGCCCTTTGGGGCCTGAGGCGGG + Intronic
1173216981 20:41094254-41094276 AGTTCTTTCAGCCCTCACGCTGG + Intronic
1174594540 20:51673500-51673522 TTCCCTTTGAGCCCAGATGCAGG + Intronic
1175829486 20:61954337-61954359 AGCCCTTCCAGGCCTGGAGCTGG + Intronic
1178927498 21:36787915-36787937 AGCCCTGGCAGCCCTGCTGGTGG - Intronic
1179037707 21:37773719-37773741 AGTACTGTCAGCCCTGGTGCAGG - Intronic
1179645350 21:42771961-42771983 AGCCCCTTCAGCTCTCTTGCGGG - Intronic
1179916740 21:44482537-44482559 ATCCCCTTCAGCCCTGTTGTAGG - Intergenic
1182800326 22:33026773-33026795 AGCATTTTCAGCTCTGATTCTGG - Intronic
1183676673 22:39302725-39302747 AGCCCTTTCAGCTGTGAGGCTGG - Intergenic
1183933558 22:41249343-41249365 GGCCCTTGCACCCCTGCTGCTGG - Exonic
1185163945 22:49246343-49246365 AGCCAGTACAGCCCTGATGCTGG - Intergenic
949395949 3:3614927-3614949 AGCCCTTAGAGCCCAGATGGGGG + Intergenic
950019545 3:9777440-9777462 AGGCCATGCAGCCTTGATGCAGG - Intronic
950488838 3:13289922-13289944 AGGCCTGCCACCCCTGATGCTGG + Intergenic
950880815 3:16321421-16321443 AGCTCTTGCAGCCCGGATGTTGG - Intronic
951349788 3:21592932-21592954 AGCCCTTGCTGCCCTGTAGCAGG - Intronic
952970072 3:38645221-38645243 AGCCCAGGCTGCCCTGATGCAGG - Intronic
954765602 3:52913052-52913074 AGACCTTTCAGCCCTCAGGGTGG - Intronic
959950396 3:112174712-112174734 AGCCCTTACAGCCCTGACACTGG - Intronic
960703147 3:120456705-120456727 AGCACTTTCAGAGCTGAGGCAGG + Intergenic
962409049 3:135125426-135125448 AGCCCTTTCCTCTATGATGCTGG + Intronic
963936083 3:151054978-151055000 ATGCCTTTCAGCACTGGTGCTGG + Intergenic
967938334 3:194747159-194747181 AGCCCTTCCAGCTCTGTTTCTGG - Intergenic
968069014 3:195774350-195774372 ATCCCTTTCAGCCCTAAAGAAGG - Intronic
975655320 4:76635593-76635615 AGGCCTTTCAGACCTGATTTAGG - Intronic
975703892 4:77092739-77092761 AGCTATTTCAACCTTGATGCTGG + Intergenic
977289971 4:95154596-95154618 AGGGCTGTCAGCCTTGATGCAGG - Exonic
983925464 4:173396446-173396468 AGTCCTTGCTGCCTTGATGCTGG - Intronic
987114985 5:14719054-14719076 GGCCCTTTCAGTCCTGAAACTGG - Intronic
992002449 5:72449229-72449251 AAACCTTTCAGCCATGATGGTGG - Intronic
992882249 5:81121952-81121974 AGCACTTTCAGCCCACAGGCAGG - Intronic
995535488 5:113131579-113131601 AGCCCTTTCAGCAATTTTGCAGG - Intronic
995635367 5:114183688-114183710 AGTCCTTTCAGTTCTGATGTTGG + Intergenic
1000046772 5:157528320-157528342 CTCCCTTTCAGCACTGCTGCTGG + Intronic
1002440928 5:179264130-179264152 TGCCTCTGCAGCCCTGATGCTGG + Intronic
1006241318 6:32681692-32681714 AGCCTTTTCAACAATGATGCTGG - Intergenic
1007220464 6:40274934-40274956 ATCCCTTTTAGCCCTGAATCCGG - Intergenic
1011661018 6:89593959-89593981 AGCCTTCTTAGCCCTGTTGCTGG - Intronic
1013603331 6:111725621-111725643 AACACTTTCAGCACTGATGCTGG + Intronic
1016363679 6:143293579-143293601 AGCCTTTTCTGTCCAGATGCAGG - Intronic
1017953708 6:159160548-159160570 AGCCCTCTCAGGCCTGCTCCAGG - Intergenic
1019695626 7:2444570-2444592 GGCTCTTTCAGCCTTGGTGCTGG - Intergenic
1019695936 7:2446173-2446195 CTCCCTTCCAGCCCTGCTGCTGG - Intergenic
1022702512 7:32775160-32775182 ATCCCTGGAAGCCCTGATGCAGG + Intergenic
1026733967 7:72936892-72936914 AGCACTTTCAGAACTGAGGCAGG - Intronic
1027363593 7:77434115-77434137 AGCCCCTTGTGCCCTGACGCTGG - Intergenic
1031970300 7:128060242-128060264 TGGCCTTTGAGCCATGATGCAGG + Intronic
1032410390 7:131690050-131690072 GTCCCTTTCAGCCATGATGGGGG + Intergenic
1034116656 7:148589584-148589606 AGCCCCTCCAGCTCTGCTGCAGG + Intergenic
1034855879 7:154546952-154546974 AGTCCTCTCAGCCCTGAAACAGG + Intronic
1035083382 7:156236012-156236034 AGCACTGTCATGCCTGATGCAGG + Intergenic
1035885153 8:3283607-3283629 TGCCCCTTCTGCCCTGAAGCAGG + Intronic
1036658120 8:10690755-10690777 AGCCGTTTCTGCCCTGATCGTGG + Intronic
1037491563 8:19401220-19401242 GGTCCTATCAGCCCTGAAGCTGG + Intergenic
1040336337 8:46417994-46418016 AGCCCTCTCATCCCAGAAGCCGG + Intergenic
1040420948 8:47240111-47240133 AGGCCTTTTCACCCTGATGCTGG - Intergenic
1041876302 8:62691214-62691236 AGTGCTTTCAGCCCTGAAGCAGG + Intronic
1043848433 8:85188493-85188515 AGCACTTTGAGCACTGAGGCAGG + Intronic
1045610968 8:103840966-103840988 AGCCCTTCCTTCACTGATGCAGG - Intronic
1045830450 8:106453710-106453732 AGGCCTTTCAGCCATAATTCAGG + Intronic
1049164689 8:141118680-141118702 TGCCCTGTCACCCCTGCTGCAGG - Intronic
1049397854 8:142409935-142409957 GGCCCTTTCAGCCTGGAGGCAGG + Intergenic
1058765445 9:108178662-108178684 AGCCCTCTCAGTTCTGATGGAGG - Intergenic
1060474033 9:123971636-123971658 AGCCTTGCCTGCCCTGATGCTGG - Intergenic
1061961216 9:133990287-133990309 GGCCCCTTGAGCCCTGCTGCTGG - Intronic
1188728098 X:33609656-33609678 TGCCCTTTCATCCCTGATAGTGG + Intergenic
1189293556 X:39902841-39902863 AACCCATTCTTCCCTGATGCTGG - Intergenic
1195049051 X:101080211-101080233 AGCCCTTTTAGGGCTGAGGCAGG + Intronic
1196097374 X:111814704-111814726 AGCCCTTTCATGCCTGAGGATGG - Intronic
1200060495 X:153481678-153481700 AGCCTTCTCACCCCTGCTGCAGG - Intronic
1200817383 Y:7547799-7547821 AGCCCAGTCAGCCCTGCTACTGG - Intergenic