ID: 1152663001

View in Genome Browser
Species Human (GRCh38)
Location 17:81551684-81551706
Sequence CAGGATCCCGCGCCCCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152662995_1152663001 0 Left 1152662995 17:81551661-81551683 CCGGGCCACCAGGGCCCAAAGGA 0: 1
1: 0
2: 6
3: 31
4: 254
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662988_1152663001 28 Left 1152662988 17:81551633-81551655 CCTCGGGGGCGTGTCTCACCAGA 0: 1
1: 0
2: 0
3: 12
4: 59
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662997_1152663001 -5 Left 1152662997 17:81551666-81551688 CCACCAGGGCCCAAAGGACAGGA 0: 1
1: 1
2: 1
3: 36
4: 302
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662991_1152663001 10 Left 1152662991 17:81551651-81551673 CCAGACAGCACCGGGCCACCAGG 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662998_1152663001 -8 Left 1152662998 17:81551669-81551691 CCAGGGCCCAAAGGACAGGATCC 0: 1
1: 0
2: 1
3: 20
4: 163
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663001 Original CRISPR CAGGATCCCGCGCCCCGCCG TGG Intronic