ID: 1152663001

View in Genome Browser
Species Human (GRCh38)
Location 17:81551684-81551706
Sequence CAGGATCCCGCGCCCCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152662988_1152663001 28 Left 1152662988 17:81551633-81551655 CCTCGGGGGCGTGTCTCACCAGA 0: 1
1: 0
2: 0
3: 12
4: 59
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662997_1152663001 -5 Left 1152662997 17:81551666-81551688 CCACCAGGGCCCAAAGGACAGGA 0: 1
1: 1
2: 1
3: 36
4: 302
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662995_1152663001 0 Left 1152662995 17:81551661-81551683 CCGGGCCACCAGGGCCCAAAGGA 0: 1
1: 0
2: 6
3: 31
4: 254
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662991_1152663001 10 Left 1152662991 17:81551651-81551673 CCAGACAGCACCGGGCCACCAGG 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
1152662998_1152663001 -8 Left 1152662998 17:81551669-81551691 CCAGGGCCCAAAGGACAGGATCC 0: 1
1: 0
2: 1
3: 20
4: 163
Right 1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663001 Original CRISPR CAGGATCCCGCGCCCCGCCG TGG Intronic
900126717 1:1072022-1072044 CGGGACCCTGCCCCCCGCCGGGG - Exonic
901026532 1:6281327-6281349 CAGTGTCCCCCGCCCAGCCGTGG - Intronic
901047305 1:6404871-6404893 CTGGGTCCCGCGCCCCACCCGGG + Intergenic
902861746 1:19251768-19251790 CAGAGTCCCCCGCGCCGCCGGGG + Exonic
905038066 1:34930031-34930053 CCGGGTCTCGCCCCCCGCCGAGG + Intergenic
905656905 1:39691342-39691364 TCGGTTCCCGCGGCCCGCCGAGG - Exonic
915354914 1:155250364-155250386 CAGGTTCCCTCACCCCACCGGGG - Exonic
919591774 1:199512220-199512242 CAGCATCCTGCCCCCCACCGTGG - Intergenic
1065099550 10:22320708-22320730 CAGGCTCCGGCGCCGCGGCGCGG - Intronic
1067431522 10:46249021-46249043 CAGGACCCCCCGGCCCGCCATGG + Intergenic
1067853218 10:49768661-49768683 CAGGAATCCTCGCCCAGCCGAGG - Intergenic
1075940769 10:126388594-126388616 CAGGGTCCCGCCCCGAGCCGCGG + Intergenic
1076606118 10:131691103-131691125 CAGGATCCCACGCCCCACTGAGG + Intergenic
1076793794 10:132789310-132789332 CAGGAGCCCGGGCCCAGGCGGGG + Intergenic
1077108067 11:850417-850439 CCAGACCCCGCGACCCGCCGCGG - Intronic
1079430888 11:20387614-20387636 CCGGAGCCCGGGTCCCGCCGCGG + Exonic
1084240664 11:67817739-67817761 CAGGATCCCGCGGCCGGTAGCGG + Intergenic
1085784828 11:79440152-79440174 CCGGATCCCGTTCCCCGCCCCGG - Intronic
1096284138 12:50283538-50283560 CCGGACCCCGCCCACCGCCGCGG + Intronic
1101902197 12:108799046-108799068 CAGCATCACGCGCCCCAACGCGG - Exonic
1103392501 12:120584698-120584720 CAGCCTCCCGCGCCGCGCAGCGG - Intergenic
1104602343 12:130162304-130162326 CGGGCTCCCGGGCCCCGCGGGGG - Intergenic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1107548754 13:41456984-41457006 CAGGCCCCCGCGCTCCGCGGTGG + Intergenic
1108220933 13:48233048-48233070 CGGGATCCGGCGCCCAGCTGCGG + Intergenic
1112343947 13:98576065-98576087 CAGGGTCCCGGGCCCGGCCCCGG - Intronic
1113653316 13:112053543-112053565 CAGGATCCCGCGAGCCGCAGGGG + Intergenic
1120209835 14:81623855-81623877 GAGTCTCCCCCGCCCCGCCGTGG - Intergenic
1122552462 14:102557361-102557383 CAGCATCCCCTGCCCAGCCGTGG + Intergenic
1123409745 15:20048451-20048473 CAGGCTCCCGCACCACACCGCGG + Intergenic
1124129475 15:26971480-26971502 GAGGAAGCCGCGCCCGGCCGAGG + Exonic
1124902247 15:33835242-33835264 TGGGACCCCGCGCCCCTCCGAGG - Intronic
1129348214 15:74937915-74937937 CCGGACCCCCGGCCCCGCCGTGG - Exonic
1129894037 15:79090643-79090665 CAGGATCTGGCGCCGAGCCGCGG + Exonic
1130952548 15:88604439-88604461 CAGGGTCCAGCGCTCCGCTGGGG - Intergenic
1132588183 16:715221-715243 CCCGGACCCGCGCCCCGCCGGGG + Exonic
1132622936 16:876220-876242 CAGGAGCCCACGCGCGGCCGCGG + Intronic
1136111045 16:28063731-28063753 CAGGGACGCGCGCCCCTCCGTGG + Intergenic
1136381971 16:29900100-29900122 CAGCTCCCCTCGCCCCGCCGGGG + Intergenic
1136993286 16:35170253-35170275 CGGGGTCCCGGGCCCCGCGGCGG - Intergenic
1138660807 16:58515910-58515932 GGGCAGCCCGCGCCCCGCCGCGG - Exonic
1141531318 16:84648690-84648712 CAGGAAGCCGCGCCCGGCCGGGG + Intronic
1142173591 16:88634965-88634987 CCGCATCCTGCGCCCCGCCCAGG - Intergenic
1145881831 17:28357718-28357740 CTGGCTCCAGCTCCCCGCCGGGG - Exonic
1148759694 17:49993355-49993377 CGGGGTCCCGCGCGCCCCCGCGG + Intronic
1149554023 17:57560350-57560372 CAGTAACCCGTGCCCCTCCGAGG + Intronic
1149655739 17:58308819-58308841 CAGGCTCCAGCGCCCGGCCACGG + Exonic
1149891204 17:60391953-60391975 CAGGCTCCGACCCCCCGCCGAGG - Exonic
1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG + Intronic
1157665951 18:49487105-49487127 CAGGAGGCCGCGCACCGCCTAGG + Intronic
1160909838 19:1469365-1469387 CAGGGCGCCTCGCCCCGCCGCGG + Exonic
1160992212 19:1864421-1864443 CACCCTCCCGGGCCCCGCCGCGG - Intergenic
1161055633 19:2189450-2189472 CAGGCTCCCGCGCAAAGCCGAGG - Intronic
1161089156 19:2351694-2351716 CAGGACCCTGAGCCCCGTCGCGG - Intronic
1161108692 19:2456596-2456618 CGCGATCGCGCGCCCCGCGGTGG + Intronic
1163690380 19:18735406-18735428 CAGGATCCCCCGCTCCCCGGGGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1168721777 19:58558407-58558429 CGGGGTCCCGGGCCCCGCGGCGG - Exonic
932345914 2:70994981-70995003 CAGGATCCCCCGCTCCACTGAGG + Exonic
938583904 2:132670631-132670653 CAGGCTCCCGCGGCCCGCAGCGG - Intronic
945188907 2:207166513-207166535 CCGGAGCCCGCGCCCCTCAGAGG + Intronic
1173672975 20:44810629-44810651 CGGGCTCCCACGCCCCGCAGCGG - Intergenic
1174343792 20:49915157-49915179 CAGGCTCCTGGGACCCGCCGAGG - Intronic
1176237977 20:64063143-64063165 TAGGATGCCGCGCGCGGCCGCGG + Exonic
1176370890 21:6060840-6060862 GAAGATGCCGCGCCCCACCGGGG + Intergenic
1176547940 21:8209430-8209452 CCGGTTCCCGCGCCCCGCCCCGG + Intergenic
1179752629 21:43477701-43477723 GAAGATGCCGCGCCCCACCGGGG - Intergenic
1179991221 21:44949170-44949192 CAGGGTCCCGAGCCCCGACTTGG + Intronic
1185038079 22:48489947-48489969 CTGGAGCCCGGGCCCTGCCGGGG - Intronic
949866065 3:8548676-8548698 CAGGATCCCTCGCGCTGCCGTGG + Exonic
950427259 3:12931195-12931217 CAGGATCCCGAGCCCTGGCCTGG - Intronic
950545728 3:13636957-13636979 CAGGATCCCGCACCCCGGACAGG - Intronic
954389324 3:50260542-50260564 CAGGATCCTGCGCCCAACCCAGG + Intergenic
956123551 3:65990201-65990223 CATGATCCCGCACCTTGCCGTGG - Intronic
959319064 3:104848105-104848127 CAGGATCCTGGGCCCAGCCTAGG - Intergenic
960948645 3:122984150-122984172 CTGTCTCCCGCCCCCCGCCGTGG + Intronic
966201065 3:177359868-177359890 CGGGAACCCGAGCCCCGCCTGGG + Intergenic
968722295 4:2216603-2216625 CAGGATCCTGCGCTCAGCCAAGG - Intronic
968809315 4:2792957-2792979 CAGGATTGCGGGACCCGCCGGGG + Intergenic
968882262 4:3307278-3307300 CATGAGCCCGCGCACCGCTGGGG + Intronic
968950529 4:3689141-3689163 CTGGATCCCACGGCCGGCCGCGG + Intergenic
976246742 4:83012641-83012663 CGGGTTCCCGCTCCCCGCCAAGG + Intronic
976431351 4:84966323-84966345 GGGGCTCCCGGGCCCCGCCGCGG - Exonic
982288715 4:153759685-153759707 CAAGACCCCGGGCCCCACCGGGG - Intronic
985423564 4:189807203-189807225 CTGGAACCCGCGCCCCGCGCCGG + Intergenic
985749778 5:1667460-1667482 CAGGACCGCGGGCGCCGCCGGGG + Intergenic
994171266 5:96662201-96662223 CAGGAGCCCGGGTCCCTCCGCGG + Intronic
1000014577 5:157266124-157266146 GAGCATCCTGCGCCCCGGCGCGG + Exonic
1001529843 5:172454228-172454250 CTTGAGCCCGCGCCCCGTCGGGG - Intronic
1005748758 6:28864197-28864219 CAGGTTCCCGCGCCCAGCCTCGG + Intergenic
1012475702 6:99613468-99613490 CAGGCTGCCGACCCCCGCCGAGG - Exonic
1019020164 6:168911531-168911553 GAGGATCCCGCTCCCCACCCAGG - Intergenic
1019536218 7:1531053-1531075 CAGGTGCCCGGGCCGCGCCGCGG - Intronic
1019828020 7:3300499-3300521 CAGGCTCCCGGGTCCCGCCCTGG + Intergenic
1022963802 7:35454796-35454818 CAGGGTCCCGGGCCTGGCCGCGG + Intergenic
1024262439 7:47582282-47582304 CGGGGTCCCCCGCCCTGCCGAGG + Intronic
1026765272 7:73155767-73155789 CGGAATCCCTCCCCCCGCCGTGG - Intergenic
1027041746 7:74965523-74965545 CGGAATCCCTCCCCCCGCCGTGG - Intronic
1027081896 7:75236846-75236868 CGGAATCCCTCCCCCCGCCGTGG + Intergenic
1027190647 7:75994037-75994059 AGGGATACCGCGCGCCGCCGAGG - Intronic
1029363040 7:100100876-100100898 CAGGTTCCCGCGCCCTCCCCAGG - Intronic
1031051868 7:116953412-116953434 CCGGAGCCCGCCCGCCGCCGGGG - Exonic
1033146127 7:138871276-138871298 CAGGATCTCCCGCCCCCCGGAGG - Exonic
1034830624 7:154304924-154304946 CAGGGCCCCGCGCCGCGCCCGGG - Intronic
1035705297 8:1670322-1670344 CAGGACCCCACACCCCTCCGTGG + Intronic
1046173298 8:110542074-110542096 CAGGAGCCCGAGGCCAGCCGGGG + Intergenic
1049697911 8:143992624-143992646 CAGCATCCCGCCCCCGGCCAAGG - Intronic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1060415222 9:123425276-123425298 CAGAATCCAGCTCCCTGCCGGGG - Intronic
1061153975 9:128846042-128846064 CAGGACCCCGGGACCCTCCGAGG - Intronic
1061169106 9:128941728-128941750 CAGGAGCCCTCGCCCCTCCCGGG + Exonic
1062581883 9:137232417-137232439 CAGGAACCCGGGCCCTGCCCTGG + Intronic
1062600249 9:137316098-137316120 CAGCGCGCCGCGCCCCGCCGAGG - Intronic
1062653407 9:137590076-137590098 CAGCGTCCCCCGCCCCGCTGGGG + Intronic
1190984381 X:55488411-55488433 CAGGATCCCCCGACCCGTCTAGG + Exonic
1191184071 X:57591981-57592003 CGCGATCCCGCCCCCTGCCGCGG - Exonic
1191213319 X:57910466-57910488 CGCGATCCCGCCCCCTGCCGCGG + Exonic