ID: 1152663164

View in Genome Browser
Species Human (GRCh38)
Location 17:81552309-81552331
Sequence GATGGCCGGCGCCGCGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663164_1152663174 22 Left 1152663164 17:81552309-81552331 CCCGCGGCGCGGCGCCGGCCATC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152663164_1152663171 11 Left 1152663164 17:81552309-81552331 CCCGCGGCGCGGCGCCGGCCATC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663164_1152663175 25 Left 1152663164 17:81552309-81552331 CCCGCGGCGCGGCGCCGGCCATC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1152663175 17:81552357-81552379 AAGCCCCGGCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 27
4: 184
1152663164_1152663173 19 Left 1152663164 17:81552309-81552331 CCCGCGGCGCGGCGCCGGCCATC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1152663173 17:81552351-81552373 AGTGAGAAGCCCCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663164 Original CRISPR GATGGCCGGCGCCGCGCCGC GGG (reversed) Exonic