ID: 1152663168

View in Genome Browser
Species Human (GRCh38)
Location 17:81552323-81552345
Sequence GGGCCCGCGCGCACGATGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663168_1152663180 22 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300
1152663168_1152663175 11 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663175 17:81552357-81552379 AAGCCCCGGCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 27
4: 184
1152663168_1152663171 -3 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663168_1152663174 8 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152663168_1152663173 5 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663173 17:81552351-81552373 AGTGAGAAGCCCCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663168 Original CRISPR GGGCCCGCGCGCACGATGGC CGG (reversed) Exonic