ID: 1152663169

View in Genome Browser
Species Human (GRCh38)
Location 17:81552327-81552349
Sequence TGACGGGCCCGCGCGCACGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663169_1152663171 -7 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663169_1152663174 4 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152663169_1152663181 30 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663169_1152663175 7 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663175 17:81552357-81552379 AAGCCCCGGCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 27
4: 184
1152663169_1152663173 1 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663173 17:81552351-81552373 AGTGAGAAGCCCCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104
1152663169_1152663180 18 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663169 Original CRISPR TGACGGGCCCGCGCGCACGA TGG (reversed) Exonic