ID: 1152663170

View in Genome Browser
Species Human (GRCh38)
Location 17:81552343-81552365
Sequence CCGGGGCTTCTCACTCTGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663170_1152663175 -9 Left 1152663170 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 101
Right 1152663175 17:81552357-81552379 AAGCCCCGGCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 27
4: 184
1152663170_1152663181 14 Left 1152663170 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 101
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663170_1152663184 29 Left 1152663170 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 101
Right 1152663184 17:81552395-81552417 CTTTACGGCAGCCCGCTGTGCGG 0: 1
1: 0
2: 1
3: 3
4: 42
1152663170_1152663180 2 Left 1152663170 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 101
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663170 Original CRISPR CCGGGGCTTCTCACTCTGAC GGG (reversed) Exonic