ID: 1152663171

View in Genome Browser
Species Human (GRCh38)
Location 17:81552343-81552365
Sequence CCCGTCAGAGTGAGAAGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663160_1152663171 26 Left 1152663160 17:81552294-81552316 CCGCCAGGTAGCGGACCCGCGGC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663161_1152663171 23 Left 1152663161 17:81552297-81552319 CCAGGTAGCGGACCCGCGGCGCG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663158_1152663171 27 Left 1152663158 17:81552293-81552315 CCCGCCAGGTAGCGGACCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663168_1152663171 -3 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663169_1152663171 -7 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663164_1152663171 11 Left 1152663164 17:81552309-81552331 CCCGCGGCGCGGCGCCGGCCATC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
1152663165_1152663171 10 Left 1152663165 17:81552310-81552332 CCGCGGCGCGGCGCCGGCCATCG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1152663171 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663171 Original CRISPR CCCGTCAGAGTGAGAAGCCC CGG Exonic