ID: 1152663172

View in Genome Browser
Species Human (GRCh38)
Location 17:81552344-81552366
Sequence GCCGGGGCTTCTCACTCTGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663172_1152663175 -10 Left 1152663172 17:81552344-81552366 CCGTCAGAGTGAGAAGCCCCGGC 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1152663175 17:81552357-81552379 AAGCCCCGGCCGCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 27
4: 184
1152663172_1152663180 1 Left 1152663172 17:81552344-81552366 CCGTCAGAGTGAGAAGCCCCGGC 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300
1152663172_1152663181 13 Left 1152663172 17:81552344-81552366 CCGTCAGAGTGAGAAGCCCCGGC 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663172_1152663184 28 Left 1152663172 17:81552344-81552366 CCGTCAGAGTGAGAAGCCCCGGC 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1152663184 17:81552395-81552417 CTTTACGGCAGCCCGCTGTGCGG 0: 1
1: 0
2: 1
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663172 Original CRISPR GCCGGGGCTTCTCACTCTGA CGG (reversed) Exonic