ID: 1152663173

View in Genome Browser
Species Human (GRCh38)
Location 17:81552351-81552373
Sequence AGTGAGAAGCCCCGGCCGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663165_1152663173 18 Left 1152663165 17:81552310-81552332 CCGCGGCGCGGCGCCGGCCATCG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1152663173 17:81552351-81552373 AGTGAGAAGCCCCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104
1152663168_1152663173 5 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663173 17:81552351-81552373 AGTGAGAAGCCCCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104
1152663164_1152663173 19 Left 1152663164 17:81552309-81552331 CCCGCGGCGCGGCGCCGGCCATC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1152663173 17:81552351-81552373 AGTGAGAAGCCCCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104
1152663169_1152663173 1 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663173 17:81552351-81552373 AGTGAGAAGCCCCGGCCGCGCGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663173 Original CRISPR AGTGAGAAGCCCCGGCCGCG CGG Exonic