ID: 1152663174

View in Genome Browser
Species Human (GRCh38)
Location 17:81552354-81552376
Sequence GAGAAGCCCCGGCCGCGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663165_1152663174 21 Left 1152663165 17:81552310-81552332 CCGCGGCGCGGCGCCGGCCATCG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152663164_1152663174 22 Left 1152663164 17:81552309-81552331 CCCGCGGCGCGGCGCCGGCCATC 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152663169_1152663174 4 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 128
1152663168_1152663174 8 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663174 Original CRISPR GAGAAGCCCCGGCCGCGCGG CGG Exonic
900610729 1:3543560-3543582 GAGAACCCCCGGGCGGGAGGCGG + Intronic
901443648 1:9293622-9293644 GAGAAGCCGCGGCGGCTCCGGGG - Intronic
903747632 1:25598961-25598983 GAGAAGCCCCAGCCACATGGAGG + Intergenic
904615356 1:31746545-31746567 GAGAAGTCCCGGGCGCCCAGCGG - Intronic
905670735 1:39788707-39788729 GAGTAGCCCCGGCCTCGAGGCGG - Exonic
912546008 1:110452452-110452474 GAGAAGCCCCGGCTGCTGCGCGG + Intronic
913938987 1:125085788-125085810 GAAAAGCCGCGGCGGCGGGGGGG + Intergenic
914044271 1:144077847-144077869 GAAAAGCCACGGCGGCGAGGGGG - Intergenic
916179288 1:162070030-162070052 GGGGAGCCCTGGCCGCGCGGCGG - Exonic
920247536 1:204599808-204599830 GACAAGCCCGGGCAGCGCAGAGG - Intergenic
924527149 1:244863306-244863328 GAGGAGCCGCGGGCGGGCGGCGG - Intronic
924561148 1:245156790-245156812 GAGAGCCCCCGGCGGCGCTGGGG + Intronic
1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG + Intergenic
1070767967 10:79067341-79067363 GCGCAGCCCCGGCCGGGCTGCGG - Intergenic
1073325863 10:102643786-102643808 GAGAAGCCCCGGCGGCGCTCCGG - Intergenic
1080496876 11:32829616-32829638 GAAAAGCCCTGGACGCGCCGAGG + Intergenic
1085396874 11:76210839-76210861 GGGTGGCCCCGGCCGCGCGCGGG + Intergenic
1088679397 11:112226381-112226403 AGGAGGCACCGGCCGCGCGGCGG + Exonic
1090699153 11:129279160-129279182 GGGACGCCGCGGCGGCGCGGCGG - Intronic
1091303767 11:134523969-134523991 GAGCCGGCCCGGCCGCGGGGAGG + Intergenic
1091386793 12:101097-101119 GAGAAGCCCAGGCCTGGCAGGGG + Intronic
1097854963 12:64452330-64452352 GAGAAGCCCCGGACGACCCGAGG + Intronic
1102854031 12:116277745-116277767 GACGGGCGCCGGCCGCGCGGGGG + Intergenic
1103856346 12:123973171-123973193 GGGAAGCCCCGGGGGAGCGGGGG - Exonic
1104891104 12:132140597-132140619 GTGAGGCCCCGGCTGGGCGGGGG - Intronic
1104901165 12:132190205-132190227 GAGGAGGAGCGGCCGCGCGGCGG - Intergenic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1106498783 13:30307470-30307492 TGGCAGCCGCGGCCGCGCGGTGG + Exonic
1107939811 13:45373624-45373646 GAGAAGCCCCGTCCAAGCAGTGG - Intergenic
1113567137 13:111325976-111325998 GAGAAGCCCCAGCAGCACAGAGG - Intronic
1117478169 14:56118303-56118325 GAGAGGCTGGGGCCGCGCGGGGG - Intronic
1119004189 14:70908500-70908522 GCGGAGCCCCGGGAGCGCGGGGG + Intronic
1122130831 14:99603990-99604012 GGGAAGCGCCGGCCGGGCGAGGG - Exonic
1123396577 15:19943777-19943799 AAAAAGCCGCGGCCGCGGGGGGG - Intergenic
1124346335 15:28923870-28923892 GAGGAGCCCCGGGGGGGCGGTGG - Intronic
1128374474 15:67065537-67065559 GGGGAGCCCCGGCGGCGAGGGGG + Intronic
1129711339 15:77821672-77821694 GAGAAGCCCAGGCTGCGCTGTGG + Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1131049293 15:89335577-89335599 GACAAGCTCCAGCCGCGCTGTGG - Intergenic
1132839680 16:1972912-1972934 GAGAAGCCCAGGCCGCGTACAGG + Intronic
1133325088 16:4937260-4937282 TCCAAGCCCCGCCCGCGCGGTGG - Intronic
1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG + Intronic
1136544662 16:30948511-30948533 GGTAAGCCCCGGCCCCCCGGAGG - Exonic
1136957297 16:34802437-34802459 GAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1136957332 16:34802562-34802584 AAAAAGCCCCGGCAGCGGGGGGG - Intergenic
1137248592 16:46726850-46726872 GAGAAGTCCCTTCCGCACGGAGG + Intronic
1140078617 16:71723887-71723909 GAGACGCCCGGCCCGCGCGACGG + Intronic
1142027964 16:87824504-87824526 GTGAAGCCCATGCCCCGCGGTGG + Intergenic
1142066551 16:88066104-88066126 GAGAAGCCCCGTCTGCCCTGAGG - Intronic
1144759758 17:17700665-17700687 GACGAGGCCCGGCCTCGCGGAGG - Intronic
1145214698 17:21042840-21042862 GGCAAGGCCCGGCCGCGCGCGGG + Exonic
1145693126 17:26765887-26765909 GAAAAGCCGCGGCAGCGGGGTGG - Intergenic
1145963800 17:28902856-28902878 GTGAAGGCCCCGCCGTGCGGCGG - Exonic
1146854531 17:36251952-36251974 CAGGAGCCCCGGCCGAGGGGAGG - Intronic
1146866088 17:36336424-36336446 CAGGAGCCCCGGCCGAGGGGAGG + Intronic
1146877789 17:36426925-36426947 CAGGAGCCCCGGCCGAGGGGAGG - Intronic
1147068958 17:37937036-37937058 CAGGAGCCCCGGCCGAGGGGAGG + Intergenic
1147073315 17:37976468-37976490 CAGGAGCCCCGGCCGAGGGGAGG - Intergenic
1147080482 17:38016573-38016595 CAGGAGCCCCGGCCGAGGGGAGG + Intronic
1147084836 17:38056006-38056028 CAGGAGCCCCGGCCGAGGGGAGG - Intronic
1147096429 17:38140533-38140555 CAGGAGCCCCGGCCGAGGGGAGG + Intergenic
1147100784 17:38179972-38179994 CAGGAGCCCCGGCCGAGGGGAGG - Intergenic
1147139627 17:38453885-38453907 GAGACGCGCGCGCCGCGCGGGGG - Intronic
1147436199 17:40417717-40417739 GAGATGCCCGGGCCGCGCGGAGG + Intronic
1150083717 17:62263019-62263041 CAGGAGCCCCGGCCGAGGGGAGG - Intergenic
1152353676 17:79796885-79796907 GGGAGGGCCCGGCCGCACGGAGG + Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1153805506 18:8705985-8706007 GACAAGCCCCCGCCGGGCGCCGG + Intronic
1154270254 18:12912241-12912263 GAGAAGCGCAGGCAGAGCGGCGG + Intronic
1160788741 19:913180-913202 GTGAAGGCCCTGCCGGGCGGCGG - Exonic
1161317377 19:3623930-3623952 GGGCAGCCGCGGCCGCCCGGGGG + Exonic
1161776291 19:6263970-6263992 GAGAAGCTCAGGCCCCGCAGTGG - Intronic
1162378293 19:10317636-10317658 GGGAAGCCCCGGCCCCCCAGCGG - Intronic
1163607268 19:18281983-18282005 GTGGGGCCCCGGCCGGGCGGGGG + Intergenic
1164659272 19:29949060-29949082 CAGAAGCCCCGTCCGGGAGGCGG - Intronic
1165419628 19:35716507-35716529 GAGAAGTCCCGGGAGCGCTGAGG - Exonic
1166317903 19:41998944-41998966 GGGACGCCCAGGCCACGCGGAGG + Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1202683315 1_KI270712v1_random:29455-29477 AAAAAGCCACGGCGGCGCGGGGG - Intergenic
1202683791 1_KI270712v1_random:31146-31168 GAAAAGCCGCGGCGGCGGGGGGG - Intergenic
929075094 2:38074360-38074382 GAGCAGCCACTGCAGCGCGGTGG + Exonic
934261129 2:91477870-91477892 AAAAAGCCGCGGCCGCGTGGGGG - Intergenic
943767588 2:191678773-191678795 GGGGAGCCCCGGGCGCGCAGCGG - Intronic
944811027 2:203328082-203328104 GAGAAGCCCCCACCTCCCGGCGG - Intergenic
947792501 2:232876191-232876213 GAGAAGGGCCGGCCAGGCGGGGG + Intronic
947815101 2:233031700-233031722 GGGAAGGCCCAGCCGCCCGGAGG + Intergenic
1168802604 20:653106-653128 GAGGGGCCCGGGCCGAGCGGCGG - Exonic
1169120617 20:3093385-3093407 TAGAAGCCCACCCCGCGCGGCGG - Intergenic
1169806553 20:9566119-9566141 GAGGAGCCCCAGCTGGGCGGCGG + Exonic
1170630027 20:18057773-18057795 GAGAGGCCTGGGCCGCGCCGCGG - Exonic
1171349047 20:24488854-24488876 GAGCATCCCCGGGCGCTCGGAGG + Intronic
1171512539 20:25696881-25696903 GCGTAGTCCCGGCCGCGCTGAGG - Intergenic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1176083393 20:63285067-63285089 GAGGAGCCCAGGCCCCGAGGAGG - Intronic
1181571172 22:23768390-23768412 GAGACTCCCAGGCCACGCGGTGG - Exonic
1182664020 22:31944486-31944508 GAGGAGACGCGGCCGCGCTGGGG - Exonic
1185271163 22:49929785-49929807 AAGACGCCCCGGCAGCGCCGAGG - Intergenic
955251472 3:57287333-57287355 GAGAACCCCCGGCAGCCTGGAGG + Intronic
963264565 3:143228101-143228123 GAGAAGCAGCGGGCGTGCGGAGG - Intergenic
963264667 3:143228523-143228545 GAGAAGCAGCGGGCGTGCGGAGG + Intergenic
964344663 3:155744232-155744254 GGCAAACCCCGGCCCCGCGGCGG - Intronic
964771121 3:160225443-160225465 GAGGAGCCCGCGGCGCGCGGAGG - Intergenic
966711771 3:182980038-182980060 GGGAAGCCCCGGCTTCGGGGCGG + Intronic
969713712 4:8858622-8858644 GCGAGGCCCCGGCCGCCCGGGGG - Intronic
977908260 4:102501567-102501589 GGGAAGCGCAGGGCGCGCGGTGG - Exonic
978620635 4:110632308-110632330 GGGAAGCGCAGGCCGCGCGCTGG - Intronic
984701301 4:182820338-182820360 GAGAAGCCCTGGCCGGATGGTGG - Intergenic
984734947 4:183099675-183099697 CCGGAGACCCGGCCGCGCGGGGG + Intronic
985445395 4:190018813-190018835 GAGAAGCCAGGGCTGCCCGGGGG - Intergenic
985783618 5:1883083-1883105 GGACAGTCCCGGCCGCGCGGTGG + Intronic
987193203 5:15500243-15500265 GGGAAGCCGCGGGCGCGCAGGGG + Exonic
988482913 5:31644602-31644624 GAGAAGCCACGGCCGGGGGTAGG - Intronic
992067476 5:73120772-73120794 GGGGAGCCGCGGCAGCGCGGAGG + Intronic
997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG + Intergenic
999767967 5:154755403-154755425 GGGAAGCCCGGGCCGCCCCGGGG + Intronic
1001640219 5:173238761-173238783 GAGCAGCTCCGGCTGCGCGCCGG + Intergenic
1007631392 6:43275317-43275339 GGGAAGCCTCGGCGGCGGGGTGG - Intronic
1016340935 6:143060855-143060877 GGGAGGCGCCGGGCGCGCGGGGG - Exonic
1018391686 6:163346018-163346040 CAGAAGCCCTGGCCTCGCTGGGG + Intergenic
1019032367 6:169024336-169024358 GGGGTGCCCCGGCCGCGCAGCGG + Intergenic
1023810346 7:43906613-43906635 GCCGAGCCGCGGCCGCGCGGAGG - Exonic
1023913901 7:44574196-44574218 GAGAAGCCTCGGCCGGGGCGAGG + Intronic
1029438125 7:100573780-100573802 GAGAGGGCCGGGCCGGGCGGCGG - Intronic
1029689319 7:102170553-102170575 GGGTAGCCCCGGCCCCGTGGGGG + Intronic
1035335431 7:158124942-158124964 GAGAAGGCCCCGCAGTGCGGAGG + Intronic
1043401742 8:79891529-79891551 GGAAAGCGGCGGCCGCGCGGGGG - Intergenic
1045047631 8:98294279-98294301 GAGCACCTACGGCCGCGCGGGGG - Exonic
1049628259 8:143636338-143636360 GAGACGCCGCAGCCTCGCGGGGG - Intronic
1056386282 9:86099588-86099610 GAGCAGCGCCGGCGGCGCGAAGG + Intronic
1057773237 9:97984702-97984724 GCCAAGCCCCGGCGGGGCGGGGG - Intronic
1060923231 9:127437341-127437363 GAGATGCCCAGGCAGCGGGGGGG - Intronic
1061006236 9:127929823-127929845 GAGAAGCCCCCGCCGGCTGGAGG + Exonic
1061123182 9:128656697-128656719 GAGTGGCCCCGGCTGCGCGCGGG + Exonic
1061481425 9:130899238-130899260 GAAAACCTCCGGCCGCACGGGGG + Intergenic
1189335456 X:40168379-40168401 GAGAAGCCTCGGCCGAGCTGGGG + Intronic
1190454028 X:50607966-50607988 GAGAAGGCACGGCTGCGCAGTGG + Exonic