ID: 1152663180

View in Genome Browser
Species Human (GRCh38)
Location 17:81552368-81552390
Sequence GCGCGGCGGCGGCTCCGCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663169_1152663180 18 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300
1152663172_1152663180 1 Left 1152663172 17:81552344-81552366 CCGTCAGAGTGAGAAGCCCCGGC 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300
1152663170_1152663180 2 Left 1152663170 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 101
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300
1152663168_1152663180 22 Left 1152663168 17:81552323-81552345 CCGGCCATCGTGCGCGCGGGCCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1152663180 17:81552368-81552390 GCGCGGCGGCGGCTCCGCCTCGG 0: 1
1: 0
2: 5
3: 23
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663180 Original CRISPR GCGCGGCGGCGGCTCCGCCT CGG Exonic