ID: 1152663181

View in Genome Browser
Species Human (GRCh38)
Location 17:81552380-81552402
Sequence CTCCGCCTCGGAGCGCTTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152663178_1152663181 -5 Left 1152663178 17:81552362-81552384 CCGGCCGCGCGGCGGCGGCTCCG 0: 1
1: 0
2: 2
3: 42
4: 381
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663179_1152663181 -9 Left 1152663179 17:81552366-81552388 CCGCGCGGCGGCGGCTCCGCCTC 0: 1
1: 0
2: 3
3: 32
4: 253
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663176_1152663181 -3 Left 1152663176 17:81552360-81552382 CCCCGGCCGCGCGGCGGCGGCTC 0: 1
1: 0
2: 6
3: 41
4: 331
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663169_1152663181 30 Left 1152663169 17:81552327-81552349 CCATCGTGCGCGCGGGCCCGTCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663177_1152663181 -4 Left 1152663177 17:81552361-81552383 CCCGGCCGCGCGGCGGCGGCTCC 0: 1
1: 0
2: 4
3: 100
4: 421
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663172_1152663181 13 Left 1152663172 17:81552344-81552366 CCGTCAGAGTGAGAAGCCCCGGC 0: 1
1: 0
2: 1
3: 13
4: 91
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14
1152663170_1152663181 14 Left 1152663170 17:81552343-81552365 CCCGTCAGAGTGAGAAGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 101
Right 1152663181 17:81552380-81552402 CTCCGCCTCGGAGCGCTTTACGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152663181 Original CRISPR CTCCGCCTCGGAGCGCTTTA CGG Intronic