ID: 1152665824

View in Genome Browser
Species Human (GRCh38)
Location 17:81568771-81568793
Sequence TACGAGGTCCACTGAAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152665824 Original CRISPR TACGAGGTCCACTGAAGATG TGG Intronic
902057585 1:13615092-13615114 TAGGAGTTCCACTGAGGATGGGG + Intronic
904320155 1:29691392-29691414 AAGGAGGCCCCCTGAAGATGTGG + Intergenic
906057910 1:42930562-42930584 TCCGAGAGCCACTGAAGCTGTGG + Intronic
910766539 1:90788161-90788183 TACAGCTTCCACTGAAGATGTGG - Intergenic
911523598 1:98958720-98958742 TTCAAGGTGCACTGAAGAGGAGG - Intronic
915264513 1:154707143-154707165 TCTGAGTTTCACTGAAGATGTGG - Exonic
1065685684 10:28282306-28282328 TCCCAGATCCACTGTAGATGAGG - Intronic
1078759123 11:14237555-14237577 CACGCTGTCCACTGCAGATGAGG - Intronic
1081398443 11:42614544-42614566 TGCGAGATTCACAGAAGATGAGG - Intergenic
1086073476 11:82824651-82824673 TATGAGGGCCACTGATGGTGTGG + Exonic
1088396933 11:109379302-109379324 TAAGAGGGCCTCTGAAGCTGAGG + Intergenic
1088438925 11:109846810-109846832 TAAGGTGTCCACTGAAAATGAGG + Intergenic
1089095298 11:115915272-115915294 TATGAGGTCCAATGAGGGTGAGG - Intergenic
1093231023 12:16542005-16542027 TAAAAGGTCCACTGATGATTTGG - Intronic
1106060991 13:26291782-26291804 TAAGAGTTCCTATGAAGATGGGG - Intronic
1116806269 14:49496614-49496636 TATGTAGTCCACTGAGGATGTGG - Intergenic
1121435080 14:93913879-93913901 TACGAAGTCCAGTTAGGATGTGG - Intergenic
1133535458 16:6698251-6698273 TAAGATGTCCACAGAAGATATGG + Intronic
1140299699 16:73744956-73744978 TACCAAGTCCACTGAAGTTGTGG - Intergenic
1149514590 17:57270789-57270811 TATAAGGTCCCCTGATGATGGGG - Intronic
1149680417 17:58503250-58503272 TTCAAGGTCCTCTGAAGATAAGG - Intronic
1152607493 17:81300100-81300122 CACCAGGTCCACAGAAGAGGTGG - Intergenic
1152665824 17:81568771-81568793 TACGAGGTCCACTGAAGATGTGG + Intronic
1154467999 18:14668523-14668545 TACCCTGTCCATTGAAGATGAGG + Intergenic
1162581733 19:11535580-11535602 TAGGGGGTCCCCTGAAGTTGAGG + Intergenic
932534064 2:72573053-72573075 TGTGAGGTCCAGAGAAGATGAGG - Intronic
939201573 2:139042328-139042350 TTCCAGGTCCACTGAGGAGGTGG - Intergenic
941666649 2:168248811-168248833 ATTGATGTCCACTGAAGATGAGG + Intergenic
946484633 2:220089200-220089222 TACCAGGAGCACTGCAGATGAGG - Intergenic
1171005692 20:21463514-21463536 TAAGAGCTCAACTGAAGATGTGG - Intergenic
1176806516 21:13489134-13489156 TACCCTGTCCATTGAAGATGAGG - Intergenic
949675182 3:6445212-6445234 TACCAGTTCCATTGAAGATGGGG - Intergenic
962674645 3:137745952-137745974 TAGGAGGTACACTGATGATACGG + Intergenic
971042970 4:22775773-22775795 AGAGAGGTCAACTGAAGATGAGG - Intergenic
975180537 4:71339245-71339267 AAAGATGTCCACTGAAAATGTGG + Intronic
975477175 4:74836531-74836553 TTCCAGGTCTACTGAAGAAGCGG + Intergenic
987491858 5:18591186-18591208 TAGCAGCTCCACTGATGATGAGG - Intergenic
994250876 5:97535630-97535652 AACCAGGTACACTGAATATGAGG - Intergenic
996593450 5:125174921-125174943 GAAGAGGGCCACAGAAGATGAGG - Intergenic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1005248713 6:23918879-23918901 TACTAGGTAGACTGAAGTTGTGG + Intergenic
1005791537 6:29307480-29307502 TACAAGGTCCACAGTCGATGAGG - Exonic
1007696405 6:43736845-43736867 TAAGAGGTCCCCTGGAGCTGTGG + Intergenic
1010133261 6:72520915-72520937 TACAAGGTCCACAGAAAAGGAGG + Intergenic
1030146184 7:106358496-106358518 TAAAAGGTCCATTGAAGATACGG - Intergenic
1038028133 8:23610432-23610454 TAAGAGGTACACTTAAGATGGGG - Intergenic
1045901895 8:107291873-107291895 TTCTATTTCCACTGAAGATGGGG + Intronic
1056299317 9:85225653-85225675 TATGAGGCCCTCTGAAGATGAGG + Intergenic
1057443903 9:95100355-95100377 TAATAGATCCACTGAAGATCTGG - Exonic
1191691577 X:63944630-63944652 TGGGGGCTCCACTGAAGATGTGG + Intergenic
1199068955 X:143453658-143453680 TACGTAGTGCAGTGAAGATGAGG + Intergenic