ID: 1152668108

View in Genome Browser
Species Human (GRCh38)
Location 17:81583514-81583536
Sequence CAGCCAGGTGGCAGGACGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 300}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152668108_1152668124 28 Left 1152668108 17:81583514-81583536 CCCCACGTCCTGCCACCTGGCTG 0: 1
1: 0
2: 1
3: 45
4: 300
Right 1152668124 17:81583565-81583587 CTAGTCCCTCGGGAAGCTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 106
1152668108_1152668115 -1 Left 1152668108 17:81583514-81583536 CCCCACGTCCTGCCACCTGGCTG 0: 1
1: 0
2: 1
3: 45
4: 300
Right 1152668115 17:81583536-81583558 GCCCCAGAGATGAGTGAGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 323
1152668108_1152668114 -5 Left 1152668108 17:81583514-81583536 CCCCACGTCCTGCCACCTGGCTG 0: 1
1: 0
2: 1
3: 45
4: 300
Right 1152668114 17:81583532-81583554 GGCTGCCCCAGAGATGAGTGAGG 0: 1
1: 0
2: 0
3: 28
4: 248
1152668108_1152668121 18 Left 1152668108 17:81583514-81583536 CCCCACGTCCTGCCACCTGGCTG 0: 1
1: 0
2: 1
3: 45
4: 300
Right 1152668121 17:81583555-81583577 CTGGCTGGCCCTAGTCCCTCGGG 0: 1
1: 0
2: 0
3: 10
4: 194
1152668108_1152668120 17 Left 1152668108 17:81583514-81583536 CCCCACGTCCTGCCACCTGGCTG 0: 1
1: 0
2: 1
3: 45
4: 300
Right 1152668120 17:81583554-81583576 GCTGGCTGGCCCTAGTCCCTCGG 0: 1
1: 0
2: 1
3: 15
4: 195
1152668108_1152668119 3 Left 1152668108 17:81583514-81583536 CCCCACGTCCTGCCACCTGGCTG 0: 1
1: 0
2: 1
3: 45
4: 300
Right 1152668119 17:81583540-81583562 CAGAGATGAGTGAGGCTGGCTGG 0: 1
1: 1
2: 4
3: 35
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152668108 Original CRISPR CAGCCAGGTGGCAGGACGTG GGG (reversed) Intronic
900108824 1:997248-997270 AAGCCAGGGGGCAGGTGGTGTGG + Intergenic
900158821 1:1213893-1213915 CAGCCAGGAGGCTGGTCCTGGGG - Intronic
900582456 1:3415771-3415793 CAGCCCGGAGCCAGGAGGTGGGG + Intronic
900619239 1:3579471-3579493 CAGCAAGGTGGCAGCACAGGTGG + Intronic
900641204 1:3688869-3688891 GCGCCAAGTGGAAGGACGTGAGG - Intronic
901012810 1:6210807-6210829 CAGCCAGGGGGCAGGAAGAGGGG - Intronic
901033463 1:6322074-6322096 CAGCCAGTTCGCACGACCTGTGG - Intronic
901400119 1:9010114-9010136 CACCCAGGGGGCAGGAAATGAGG + Intronic
902629864 1:17698359-17698381 CAGCCATGTCCCAGGACTTGGGG + Intergenic
902983739 1:20142960-20142982 CAGCCAAGTGGCAGGGGGTGTGG + Intronic
904051742 1:27643950-27643972 CTGCCAGGTGGGAGGACCTTTGG - Intergenic
904168954 1:28577651-28577673 AAGCCAGGTTGCATGATGTGAGG + Exonic
904276866 1:29390629-29390651 CAGCCAGGTTGGAGGAGGGGCGG - Intergenic
905214501 1:36397401-36397423 CAGCCGGGTGGCTGGTCGTTAGG - Intronic
905826278 1:41028151-41028173 CAACCAAGTGGCAGCAGGTGGGG - Exonic
905882222 1:41471672-41471694 CTGCCCGGTGGCAGGGCGTTGGG + Intergenic
906213244 1:44024023-44024045 CTGCCAGAAGGCAGGAGGTGTGG - Intronic
906586428 1:46983164-46983186 CAGCCTGGTGGCAGCAAGGGTGG + Intergenic
907045337 1:51297005-51297027 TAGCCAGGAGGCAGGAGCTGTGG - Intronic
907243804 1:53094678-53094700 CAGCCAGGCGGCAGGAAGACAGG - Intronic
907307347 1:53520682-53520704 CAGCCAGCTGTGTGGACGTGTGG + Exonic
907438066 1:54462185-54462207 CAGCCAGCTGGGAGGAGTTGGGG + Intergenic
908650558 1:66328616-66328638 CAGGCAGGTGACAGGAAGTGAGG - Intronic
909010897 1:70333852-70333874 CAGCCAGGTCTCAGGAAGAGTGG - Intronic
910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG + Intronic
911044100 1:93614696-93614718 CAGCCAGGTGGGAGGGCATAGGG - Intronic
911183809 1:94884172-94884194 CAGCCAGGTGGGAGGTGGGGTGG - Intronic
913281773 1:117191702-117191724 AACCCAGGTGGCAGAAGGTGTGG + Intronic
913663952 1:121030502-121030524 CTGCCAGGTGCCAGGATGTTTGG + Intergenic
914944724 1:152053702-152053724 GAGCTAGGTGGGAGGGCGTGGGG - Intergenic
915130143 1:153690177-153690199 CAGGCAGGAGGCAGGATCTGAGG - Intronic
915604414 1:156941651-156941673 TAGCCAGGTGGCAGGCTGTGGGG + Intronic
916311821 1:163406656-163406678 CAGCCAAGTGGCACCACATGTGG + Intergenic
919857050 1:201713021-201713043 CAGCCAGGTGGCCTGATGCGTGG + Intronic
920177746 1:204113705-204113727 CAGCCTGGAGGAAGGAGGTGGGG + Intronic
920223993 1:204424802-204424824 CAGGCTGGTGGCAGGAGCTGGGG - Exonic
921320564 1:213934452-213934474 CACCCAGGTGGCGGGGCCTGTGG - Intergenic
922192758 1:223333778-223333800 CAGCCAGGAGAGAGGACCTGGGG - Intronic
922704177 1:227780293-227780315 CAGGCAGCTGGCAGGAGGTGGGG + Intronic
1062947457 10:1472395-1472417 CAGCCAGGTGTGAGGAGGTCTGG + Intronic
1064970108 10:21056850-21056872 CATCCAGGAGGGAGGAGGTGTGG + Intronic
1067056805 10:43057280-43057302 CAGCCAGGTGGCAAGAGCTCTGG - Intergenic
1067476490 10:46570832-46570854 CAGCCAGGAGGAGGGACCTGTGG + Intergenic
1067618248 10:47770949-47770971 CAGCCAGGAGGAGGGACCTGTGG - Intergenic
1069059638 10:63882197-63882219 CAGCAAGGTGGCAGAATATGAGG - Intergenic
1069709216 10:70478460-70478482 CAGCCAGGAGGCTGGATGTCGGG + Intergenic
1069943935 10:71973291-71973313 CAGACAAGTGGCAGGACTGGAGG - Intronic
1070525538 10:77292926-77292948 CATCGAGGTGGCAGGATTTGGGG + Intronic
1070689501 10:78514173-78514195 CAGCAAGGGGGCTGGAGGTGAGG + Intergenic
1071511565 10:86265545-86265567 CAGCCACGTGGCAGGGCTGGTGG - Intronic
1073887913 10:108062902-108062924 CAGCAATGAGGCAGGGCGTGTGG + Intergenic
1076014490 10:127016405-127016427 CAGCCAGAGGACAGGGCGTGAGG + Intronic
1076213758 10:128675525-128675547 CAGGCAGGTGCAAGCACGTGGGG - Intergenic
1076724725 10:132407995-132408017 CAGCCGGGAGGGAGGACGGGAGG + Intronic
1076824122 10:132958793-132958815 CAGCCAGGTGACAGGCTGTGCGG + Intergenic
1077035605 11:493022-493044 GAGCCAGGTGGTAGCAGGTGGGG + Intergenic
1077317124 11:1924606-1924628 CAGCCACGTGGCAGGCCGGGAGG + Intronic
1077486129 11:2839168-2839190 CAGGCAGGTGGGAGGGGGTGGGG - Intronic
1080050693 11:27856039-27856061 CAGCCTGGTGGTATGACTTGCGG + Intergenic
1080752855 11:35166672-35166694 CAGCCAGGCGCCAAGACGTTGGG + Intronic
1081488187 11:43547691-43547713 AAGCCAGGTTGCGGGATGTGGGG - Intergenic
1081525588 11:43925426-43925448 CAGCCAGGTGGCTGGATATGTGG + Exonic
1081775198 11:45671630-45671652 CCCCCAGGAGGCAGGACCTGTGG - Intergenic
1083052815 11:59792245-59792267 CAACCAGGTGGCAGGAAAGGTGG - Intronic
1083138914 11:60705383-60705405 CAGCCTGGTGGGAGGAGGCGTGG - Intronic
1083264049 11:61537970-61537992 CACCGAGGTGGCAGTGCGTGAGG + Intronic
1083648213 11:64185449-64185471 CAGCCAGGAGGCAGGAGGGCCGG + Exonic
1084041217 11:66543740-66543762 CAGCCATGTGGAGGGGCGTGTGG + Exonic
1084575723 11:69986714-69986736 CAGCCAGGGGGGAGGAAGTCAGG - Intergenic
1085411983 11:76296832-76296854 CAGCCAGGTGGTAGGAAGGTGGG + Intergenic
1086889552 11:92240937-92240959 CAGCAATGTGGCAGGAAGGGGGG - Intergenic
1087076105 11:94128669-94128691 CTCCCGGGTGCCAGGACGTGAGG + Intergenic
1091797226 12:3304282-3304304 CATCCAGGAGGCAGGACACGGGG + Intergenic
1092083388 12:5736327-5736349 CACCCAGGTGGGAGGACTAGAGG + Intronic
1092674930 12:10905521-10905543 CAGGCAGGTGCCAGGACGCCCGG - Intronic
1093872931 12:24314062-24314084 CAGCATGGTGGCAGTACATGTGG - Intergenic
1093920029 12:24849279-24849301 CAGCCAGTTGGCAGCAGGTGTGG + Intronic
1094494698 12:30982125-30982147 CACCCAGGGGTCAGGACGTGGGG - Intronic
1097679294 12:62633646-62633668 CAGCCTGATGGCAGGAGATGGGG + Intergenic
1103507120 12:121449125-121449147 GAGCCAGGTGGCAGGATGGGAGG + Intronic
1103730107 12:123021715-123021737 CAGGGAGGTGGCAGAACATGCGG + Intronic
1103753471 12:123183804-123183826 CAGCCAGGTGGCAGGACAGCAGG + Intronic
1103932922 12:124460074-124460096 CAGCCAGGTGGGAAAACGAGTGG - Intronic
1105286812 13:19011474-19011496 CAGCCAAGTGGCAGGCCAGGAGG - Intergenic
1105601048 13:21887183-21887205 GTGCTAGCTGGCAGGACGTGTGG + Intergenic
1107481592 13:40789891-40789913 CAGCCAAATGACAGGACTTGGGG - Intronic
1110450597 13:75635484-75635506 CAGCGAGGTGGCAGGTTATGCGG - Intronic
1111682245 13:91458221-91458243 CAGCAAGGAGGCAGCATGTGTGG + Intronic
1113335535 13:109372834-109372856 GAGCCAGGAGGCTGGAGGTGGGG - Intergenic
1114577847 14:23729708-23729730 AAGCCAGAGGGGAGGACGTGGGG - Intergenic
1114624602 14:24120664-24120686 TAGCCAGGTGGTAGGATCTGAGG + Intronic
1116727237 14:48575973-48575995 CAGCCAGGTGGCAGCAAGGCTGG - Intergenic
1117690482 14:58299640-58299662 CAGCCAGGACGCAGGAGCTGAGG - Intronic
1118593567 14:67419344-67419366 CAGCCAGGTGGGAGCCCCTGAGG - Intergenic
1121990583 14:98552994-98553016 CAGCCAGGATGCAGGAGATGGGG + Intergenic
1122985213 14:105208738-105208760 CAGCCAGGTGGCATGGAGTGGGG - Intergenic
1125608991 15:40958304-40958326 CAGACAGGTGGCAGGACTGCCGG + Intergenic
1128806932 15:70538149-70538171 CAACCAGGGAGCAGGAGGTGGGG - Intergenic
1130580907 15:85135988-85136010 AAGCCAGGTGGAAGGACGGCTGG + Intronic
1131373683 15:91905929-91905951 CAGCAAGGTGGCCCGACTTGGGG - Intronic
1132953905 16:2580940-2580962 CAGGCAGGGGGCAGGATGGGAGG - Intronic
1132960440 16:2619223-2619245 CAGGCAGGGGGCAGGATGGGAGG + Intergenic
1135561611 16:23480883-23480905 CAACCTGGAGGCAGGAGGTGTGG - Intronic
1136413992 16:30092501-30092523 CAGCCAGATCGCAGGAGGTGCGG + Exonic
1137454259 16:48606189-48606211 AAGCCAGGTGGCAGGAGGGATGG - Intronic
1139430662 16:66909444-66909466 CAGCCAGGTGGCTGGGCTGGGGG - Intronic
1141674153 16:85508842-85508864 CAGCCTGGTGTCAGGTCCTGGGG + Intergenic
1142493388 17:292999-293021 CAGCCAGGATGGAGGACGTGGGG - Intronic
1142530047 17:573371-573393 CAGGGAGGAGGCAGGAAGTGGGG - Intronic
1143902496 17:10184659-10184681 GAGCTATGTGGCAGGACCTGGGG - Intronic
1144626236 17:16845719-16845741 CAGACAGCTGGCAGGAGGTGCGG + Intergenic
1144657591 17:17047228-17047250 CAGGCAGCTGGCATGATGTGTGG + Intronic
1144880197 17:18427001-18427023 CAGACAGCTGGCAGGAGGTGCGG - Intergenic
1145152038 17:20517383-20517405 CAGACAGCTGGCAGGAGGTGCGG + Intergenic
1145270310 17:21401291-21401313 CAGCCAGGTGTGAGGGCCTGGGG - Intronic
1145288165 17:21522007-21522029 AAGCCAGGAGGCAGCAGGTGTGG + Intergenic
1146163407 17:30571654-30571676 CAGACAGCCGGCAGGAGGTGCGG + Intergenic
1147580380 17:41624413-41624435 CAGACAGCCGGCAGGAGGTGCGG + Exonic
1148143058 17:45341976-45341998 CAGCAGAGTGGCAGGAAGTGAGG - Intergenic
1150292615 17:63990460-63990482 CAGCCAGGGGGGTGGGCGTGGGG - Intergenic
1150704362 17:67474072-67474094 GAGCCAGGTAGCAGGAGGTGTGG + Intronic
1151035272 17:70791949-70791971 CAGCCAGGTGGAAGTACATAGGG + Intergenic
1151382657 17:73736337-73736359 CAGGGAGGTGGCAGGGAGTGAGG + Intergenic
1151878820 17:76882292-76882314 CAGACAGGTGAGGGGACGTGGGG + Exonic
1152258540 17:79254327-79254349 CCCCCAGGTGGCAGCAGGTGAGG + Intronic
1152535549 17:80948653-80948675 CAGGCAGGTGGGTGGAGGTGAGG + Intronic
1152629365 17:81403191-81403213 CAGCCAGAAGCCAGGACGGGGGG - Intronic
1152668108 17:81583514-81583536 CAGCCAGGTGGCAGGACGTGGGG - Intronic
1153228230 18:2913567-2913589 CAGCCAGGCTGCAGGGAGTGAGG + Exonic
1153388165 18:4523123-4523145 CAGGGAGGTGGGAGGACATGGGG + Intergenic
1155192976 18:23447698-23447720 CAGCAAGATGGCAGGACTTGAGG - Intergenic
1156514978 18:37671687-37671709 CAGGCAGAGGGCAGGTCGTGGGG - Intergenic
1157863135 18:51159633-51159655 CAGGCATGTGGCAGGCTGTGGGG - Intergenic
1158015354 18:52776609-52776631 GAGCCAGGTTGCAGGAGGTGGGG + Intronic
1158675402 18:59513545-59513567 GAGGCAGGTGGCAGGACAGGTGG + Intronic
1160584416 18:79904476-79904498 CAGCCAGGCGGCAGCTCTTGCGG - Intronic
1160901040 19:1428893-1428915 CAGCCAGGTGCCAGCCAGTGGGG + Exonic
1161033740 19:2072532-2072554 AAGCCGGGGTGCAGGACGTGGGG + Exonic
1161443429 19:4305030-4305052 CGGCCAGGAGGGAGGGCGTGGGG - Intronic
1161470902 19:4456393-4456415 CAGGGAGGTGGCAGGAAGTGGGG - Intronic
1161592150 19:5133725-5133747 CAGCCAGGAGGCAGGTGGAGGGG + Intronic
1162122040 19:8476788-8476810 CAGACAGGTGGCAGGATGGAAGG + Intronic
1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG + Intronic
1162495572 19:11021570-11021592 CAGCCCCGGGGCAGGACGTCAGG + Intronic
1162774240 19:12969438-12969460 CAGCAAGTTGGGAGGAGGTGTGG + Intronic
1162792398 19:13069873-13069895 CAGCCACGAGGCAGGGCCTGGGG + Intronic
1163366955 19:16880786-16880808 CAGACAGGGGGCAGGAGATGAGG - Intergenic
1163641908 19:18466823-18466845 CAGCCAGGGGACAAGACCTGAGG - Intronic
1163664455 19:18596748-18596770 CGGCCAGGCGGCAGGAGGTCTGG + Exonic
1164535065 19:29079580-29079602 CAGACAGGAGGCATGAAGTGCGG - Intergenic
1165103025 19:33450189-33450211 CAGCCAGTAGGCAGCACGGGGGG - Intronic
1165243529 19:34484538-34484560 CAGGCAGGTGCCAGGAAGAGAGG + Intronic
1166219011 19:41353545-41353567 CCGCGAGGAGGCAGGACTTGGGG - Exonic
1166977289 19:46612101-46612123 CAACCAGGTGGCAGGAAAAGGGG - Intergenic
925486289 2:4335652-4335674 CAGCCATGTGTCAGCACCTGAGG + Intergenic
926936683 2:18092867-18092889 TAGCCAGGGGGCAGGTCATGTGG - Intronic
927153061 2:20206515-20206537 CAGCCAGGTGGCGAGAAGTGTGG + Intronic
927880066 2:26684042-26684064 AAGGAAGGAGGCAGGACGTGCGG - Intergenic
928282017 2:29955389-29955411 CAGGCAGGGAGCAGGACCTGGGG + Intergenic
928285372 2:29985826-29985848 CACCCAGGAGGCTGGACCTGGGG - Intergenic
929419540 2:41776877-41776899 CAGCAAGGCTGGAGGACGTGGGG - Intergenic
931463502 2:62467814-62467836 AGGCCAGGTGGCAGGGCCTGGGG + Intergenic
931811090 2:65855866-65855888 CAGCCTGGTGGGAGGTTGTGTGG + Intergenic
932469449 2:71944391-71944413 CAGGCAGGAGGCAGGACCTCAGG - Intergenic
932491822 2:72127484-72127506 CAGGGAGGTGGCAGAATGTGCGG + Intergenic
934857755 2:97739554-97739576 CAGCCAGACTGCAGGACCTGGGG - Exonic
936095500 2:109527975-109527997 CAGCCAGGCGGGAGGACGGGTGG + Intergenic
936519475 2:113202531-113202553 CAGCCAGAGGGCAGGATGAGGGG - Exonic
937066739 2:119023414-119023436 AAGTCAGGTGGCAGGTGGTGGGG + Intergenic
937296174 2:120811190-120811212 AAGCCAGATGGCAGGAGGAGTGG + Intronic
937446446 2:121962709-121962731 CAGCCAGGTGGCACCAGGAGGGG - Intergenic
938416155 2:131105312-131105334 CGGCCAGGACGCCGGACGTGCGG + Exonic
942531552 2:176915500-176915522 GAGCCAGGTGGCAGACAGTGGGG - Intergenic
942776367 2:179587099-179587121 CAACCAGGTGGAAGGGAGTGGGG - Intronic
943610759 2:190031112-190031134 CAGCCAGGTGACAGGAGGATGGG + Intronic
944606432 2:201355744-201355766 CAGCCACTTGGCAGGTGGTGCGG + Intronic
946500835 2:220245623-220245645 CAGCCAGGTGGCAGGTGGGCTGG - Intergenic
947821774 2:233076859-233076881 CAGCCAGTTGGCAGGGTGTGGGG + Intronic
947860768 2:233355445-233355467 CAGGCAGGTGGCTGGACAGGTGG + Intronic
948836572 2:240628865-240628887 AACCCAGGTGGTGGGACGTGTGG + Intronic
948836719 2:240629459-240629481 CAGCCGGGTGCCAGGAGGGGTGG + Intronic
948859049 2:240744069-240744091 CAGGCAGGTGGGAGGACAGGAGG + Intronic
948878977 2:240846185-240846207 CAGCCAGGTGGGGGGAGGGGAGG + Intergenic
1170941018 20:20848088-20848110 CAGGCAGGTGGCTGGCCTTGGGG + Intergenic
1171432987 20:25097572-25097594 TAGCCAGCTTGGAGGACGTGTGG + Intergenic
1172011773 20:31849855-31849877 CAGCCTGCTGGCTGCACGTGTGG - Intronic
1172486901 20:35303899-35303921 AAGCCAGCTGGCGGGCCGTGCGG + Exonic
1173576263 20:44114756-44114778 CAGCCAGCTGGCTGGAGGAGGGG - Intronic
1173744532 20:45426360-45426382 CGGCCAGGTGGGAGGAGGTAGGG - Intergenic
1173837395 20:46134875-46134897 CAGCCAGTGGGCAGGGGGTGAGG + Intergenic
1173928449 20:46798500-46798522 GAGGCAGGAGGCAGGAGGTGAGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174109665 20:48189946-48189968 CAGCCAGAGGACAGGACGGGAGG - Intergenic
1174331401 20:49821909-49821931 CAGCCAAGTGGGAGGTGGTGGGG + Intronic
1174931258 20:54817753-54817775 CAGCTAGGTGGCAGTACCTCAGG + Intergenic
1175251115 20:57610742-57610764 GAGCCAGATGGCAGGAGCTGGGG - Intronic
1175726292 20:61320840-61320862 CGGCCAGGTGGCTGGAGGGGTGG + Intronic
1175985899 20:62764046-62764068 CAGCCAGGTGGCAGCAGGGCTGG + Intergenic
1176101936 20:63368379-63368401 CAGCCAGAGGGCAGGGTGTGAGG - Intronic
1176110742 20:63409704-63409726 CAGCCCAGTGGCAGGAAGTGAGG - Intronic
1176370209 21:6057867-6057889 TAGCTAGGTTGCAGGACGTGAGG + Intergenic
1179753310 21:43480674-43480696 TAGCTAGGTTGCAGGACGTGAGG - Intergenic
1182566736 22:31205767-31205789 AAGCCAGGTGGCAGGGCCTTGGG + Exonic
1182619861 22:31613146-31613168 CAGCCAGGAGGCAGGAGCAGCGG + Exonic
1183176717 22:36229828-36229850 CAGCCAGGTGAAAGGGCATGAGG - Intronic
1183181512 22:36263265-36263287 CAGCCAGGTGAAAGGGCATGAGG + Intronic
1183383716 22:37503230-37503252 CAGGGAGGGGGCAGGAGGTGAGG + Intronic
1183633155 22:39045628-39045650 CAGGCAGGGGGCAGGACGGAGGG - Intronic
1184420918 22:44382429-44382451 CAGCCAGGAGGCAGGGGATGGGG + Intergenic
1184628279 22:45755039-45755061 AAGCCAGGTGGCAGGGCATGGGG + Intronic
1184991868 22:48175863-48175885 CAGGCAAGTGGCTGGATGTGGGG - Intergenic
1185198287 22:49486304-49486326 GAGCCAGGTGGCAGGACCTGGGG - Intronic
1185302162 22:50087559-50087581 CAGCCAGGTGCCAGCACCTGTGG + Intergenic
1185390524 22:50558694-50558716 CAGGCAGGTGGCAGGGCAGGGGG + Intronic
950793674 3:15493634-15493656 CAGCCAGGTGACAGGTCATGGGG + Intronic
951675306 3:25233380-25233402 TAGCAAGGTTGCAGGACGTAAGG - Intronic
953983081 3:47422413-47422435 CATCCAGGTGGCAGGCCTTGGGG + Intronic
954807453 3:53228818-53228840 CTGCCACGTGGCAGTAAGTGGGG + Intronic
960087979 3:113611152-113611174 GAGCCAGGTGGAAGAAGGTGGGG - Intronic
960949924 3:122992653-122992675 CATCCAGTTGGCATGAGGTGAGG + Intronic
961483626 3:127200417-127200439 CAGGGAGCTGGGAGGACGTGTGG + Intergenic
962883488 3:139601063-139601085 CAGCCAGGGAGCAGGCAGTGAGG + Intronic
963754832 3:149224152-149224174 AAGGCATGTGGCAGGAAGTGGGG + Intergenic
965540385 3:169865817-169865839 CATCCAGGTGGGTGGACATGAGG + Intronic
965837897 3:172871235-172871257 CAGCCTGGGGGCTGGGCGTGGGG + Intergenic
966846656 3:184135601-184135623 CAGCCAGAGGGCAGGAAGGGTGG + Intronic
968268096 3:197378116-197378138 CACCCAGGAAGCAGGAAGTGCGG - Intergenic
968472623 4:789012-789034 CAACCTGGTGGCAGGGCCTGGGG - Intronic
968641509 4:1717249-1717271 CAGCCAGGTGTCAGGGCGCAGGG + Exonic
968672768 4:1861005-1861027 CAGCCAGCTGCCAGGTCATGAGG + Intergenic
968912887 4:3484890-3484912 CAGCCCGGGGGAAGGAAGTGTGG + Intronic
968994259 4:3935889-3935911 CAGGCCTGTGGCAGGACCTGTGG + Intergenic
969587394 4:8102278-8102300 AAGCCTGGTGGAAGGAGGTGAGG - Intronic
973759013 4:54100388-54100410 CAGCGAGGGCGCAGGCCGTGAGG - Exonic
973944733 4:55945001-55945023 CAGAGAGGTGGCAGGAACTGAGG - Intergenic
977770204 4:100849050-100849072 CAGCTAGATGGCAGGCCCTGTGG + Intronic
979558424 4:122076631-122076653 AAGCCAGGTGGCAGGGCCTGGGG - Intergenic
979758697 4:124373716-124373738 CAGCCTGGTGGCAGCAAGGGTGG + Intergenic
982063238 4:151625344-151625366 CAGGCAGGTGGCAGGCAGTGGGG - Intronic
982357768 4:154489412-154489434 CAGGCAGGTGGCAGAGAGTGGGG + Intronic
983780182 4:171660913-171660935 CAGCCATGTGGAAGGCAGTGTGG + Intergenic
984155993 4:176196596-176196618 GAGCCAGGTGACAGGCCCTGTGG + Intergenic
985704970 5:1395148-1395170 CAGGAAGGTGGAGGGACGTGGGG - Intronic
993298521 5:86175945-86175967 CAGCAGGGTGGGAGGAGGTGAGG + Intergenic
994168077 5:96628884-96628906 CAGCCATTTTGCAGGATGTGTGG + Intronic
997597837 5:135119023-135119045 CAGCCAGAGGGCAGGGCATGTGG + Intronic
997622370 5:135307200-135307222 CACCAAGGAGGCAGGATGTGAGG + Intronic
997624326 5:135321310-135321332 CAGCCAGCTGGCAGCAAGAGGGG - Intronic
998474896 5:142412325-142412347 GAGCCAGGTGGCTGGAAGTTGGG - Intergenic
998475134 5:142414061-142414083 AGGGCAGGTGACAGGACGTGAGG - Intergenic
998565662 5:143213846-143213868 CAGCCAGATGGCAAGACATGAGG - Intronic
999450709 5:151675804-151675826 CAGGCAGGAGACAGGATGTGGGG - Intronic
1001821657 5:174715046-174715068 CACCCAGCTGGAAGGAGGTGGGG + Intergenic
1005303652 6:24494421-24494443 CAGCCAGGCAGCAGAACGCGGGG + Intronic
1006427712 6:33976538-33976560 AAGCCTGGTGGCAGGTCTTGGGG + Intergenic
1007629459 6:43264777-43264799 GAGCCAGGTGGATGGCCGTGGGG + Intronic
1007727318 6:43924318-43924340 CATGCAGGCGGCAGGAAGTGGGG - Intergenic
1011536270 6:88379674-88379696 CAGCAAGGTGGCAGGTTTTGCGG + Intergenic
1012508825 6:99979019-99979041 CATCCAAGTGGTAGGAGGTGGGG + Intronic
1014281901 6:119450809-119450831 CAGGGACGTGGCAGGACATGTGG - Intergenic
1016995910 6:149962535-149962557 CAGCCAGGTGACAGGAGGAGGGG - Intergenic
1017000690 6:149995444-149995466 CAGCCAGGTGACAGGAGGAGGGG - Intergenic
1017005905 6:150027846-150027868 CAGCCAGGTGACAGTAGGAGGGG + Intergenic
1018720028 6:166565432-166565454 CAGCCAGGTGCCAGGGAGGGCGG - Intronic
1018838765 6:167504391-167504413 GAGCCAGGTGGCGGGAGGGGTGG + Intergenic
1018923448 6:168191152-168191174 CAGGCAGCTCGCAGGAGGTGGGG + Intergenic
1019129397 6:169862652-169862674 CAGCCAGGAGCCAGGACCTGGGG - Intergenic
1020067628 7:5201091-5201113 CAGCCAGGTGACAGGACTTCAGG - Intronic
1020123276 7:5517758-5517780 CAGGCAGGTGGCAGGAGGCCTGG - Intergenic
1020204799 7:6105591-6105613 CAGCCAGGTGGCTAGGCCTGGGG - Intronic
1021798883 7:24284689-24284711 CAGGGAGGTGGCAGGGCGCGGGG - Intronic
1023466235 7:40458227-40458249 CAGCCTGGGGGCAGGCCATGCGG - Intronic
1026873207 7:73865657-73865679 AGGCCAGGTGCCAGGAGGTGAGG - Exonic
1027185724 7:75969502-75969524 CAGCCAGGTGGGGGCACGGGAGG - Intronic
1028121238 7:87059033-87059055 CAGCCAGGTTTGAGGACCTGGGG - Intronic
1032084023 7:128874312-128874334 CAGCCAGGTGGTAGCACAGGTGG - Intronic
1034252866 7:149706379-149706401 CAGCCAGGCGGGAGGATGAGGGG - Intergenic
1034398783 7:150847749-150847771 CAGCCAGGGAGCAGGAAGAGAGG + Intronic
1035240196 7:157524194-157524216 CAGCCAGATGGCAGGAGTCGGGG - Intergenic
1035431888 7:158828990-158829012 CACCCAGGCGGCAGGTCGCGGGG + Intronic
1036185027 8:6615171-6615193 CACCCAGGTCTCAGGACCTGAGG + Intronic
1038697625 8:29819908-29819930 GAGCCAACTGGCAGGACCTGAGG - Intergenic
1038740628 8:30213570-30213592 CAGCCAGGTGGAAGGAAGCGGGG - Intergenic
1039495161 8:37974914-37974936 CAGCCATGTGCCAGGGCATGGGG - Intergenic
1042029819 8:64463828-64463850 CCTCCAGGTGACAGGACTTGTGG - Intergenic
1042443255 8:68852410-68852432 CAGCCAGTTGGAAAGACATGTGG - Intergenic
1042930978 8:74013946-74013968 CATCCATATGGCAGGAGGTGGGG + Intronic
1045294103 8:100859218-100859240 CAGCCTGGGGGCAGGCCGAGAGG + Intergenic
1045320809 8:101080369-101080391 CAGGCAGGAGACAGGATGTGGGG + Intergenic
1045582818 8:103499464-103499486 CGCCCAGGTGTCAGGACCTGAGG - Intergenic
1046553889 8:115752207-115752229 CTTCCAGGTGGCAGGAAGCGGGG + Intronic
1048017180 8:130507854-130507876 CAGCTAGGTGGCAGGGCGGGTGG - Intergenic
1048035735 8:130675670-130675692 CCGCCAGGTGGCAGTATCTGAGG - Intergenic
1048187957 8:132261570-132261592 GAGGCAGGTGGCAGAATGTGTGG + Intronic
1048454318 8:134564346-134564368 CAGCAAGGGGACAGGGCGTGGGG - Intronic
1048705393 8:137147794-137147816 TAGCCAGGTGGCAGGTGATGGGG - Intergenic
1049351446 8:142166941-142166963 CAGCCATGTGCCAGGAGCTGGGG + Intergenic
1049397858 8:142409943-142409965 CAGCCTGGAGGCAGGGAGTGTGG + Intergenic
1049401322 8:142428767-142428789 CAGCCCACTGGCAGGACGGGCGG - Intergenic
1049509260 8:143019300-143019322 GAGCCAGCCGGCAGGCCGTGGGG - Intronic
1049705476 8:144040201-144040223 CAGCCTCGTGGCAGGCCCTGTGG + Exonic
1051171645 9:14323039-14323061 CAGCAACGTGGCGGGAAGTGAGG - Intronic
1051711198 9:19933029-19933051 CAGCCCTGGGGCAGGAGGTGGGG + Intergenic
1053284763 9:36842938-36842960 CAGCCAGGTTGGACGAGGTGTGG + Intronic
1055103610 9:72490495-72490517 CAGCCAAGTGGAAGGACAGGAGG + Intergenic
1056927271 9:90845614-90845636 AGGCCTGGTGGCAGGAGGTGAGG - Intronic
1057297828 9:93859754-93859776 CAGTCAGGTGGCGGGGCGGGGGG - Intergenic
1058747964 9:108010138-108010160 CAGCAGGGTCGCAGGACCTGTGG + Intergenic
1058890537 9:109357055-109357077 CAGCAAGGTGGCAGGGCTTGGGG - Intergenic
1060798601 9:126529161-126529183 CAGCCTGGAGCCAGGAGGTGCGG - Intergenic
1060872067 9:127050627-127050649 CAGGCCGGGGGCAGGAGGTGGGG - Intronic
1061264456 9:129497213-129497235 AAGCCAGCTGGCAGGGCCTGGGG + Intergenic
1061941080 9:133884305-133884327 CAGCTGGGAGGCAGGACGCGTGG - Intronic
1062200283 9:135299229-135299251 CAGGCAGGTGGCAGGGCCAGAGG - Intergenic
1062293013 9:135805851-135805873 CAGCCAGGTGAGGGGACGCGGGG - Intergenic
1062396861 9:136356071-136356093 CAGGGAGGGGGCAGGGCGTGGGG + Intronic
1062601423 9:137320221-137320243 CTGTCTGGGGGCAGGACGTGGGG - Intronic
1186521151 X:10208170-10208192 CAGCCATGTACCAGGGCGTGTGG - Exonic
1187641287 X:21292804-21292826 CCCCCAGATGGCAGGGCGTGTGG - Intergenic
1190988484 X:55522019-55522041 CAGCCACCTGGCAGAACCTGAGG - Intergenic
1194930955 X:99886983-99887005 GAGCCAGGTGGCTGGACTAGAGG + Intergenic
1196393386 X:115233677-115233699 CAAGCAGGTGACAGGACGGGGGG - Exonic
1196408901 X:115395511-115395533 CAGCCTGGAGGCAGGAGGAGTGG + Intergenic
1196828589 X:119759228-119759250 CCGCCAGGTGGAGGGGCGTGAGG - Exonic
1197463373 X:126771398-126771420 CAGCCAGGAGGCTGGTAGTGTGG + Intergenic
1197767286 X:130067278-130067300 CAGCCAGGTGGCAGCCCCAGGGG - Exonic
1200041783 X:153375961-153375983 CAGCCAGGTGGCTGGAGAGGAGG + Intergenic
1200063029 X:153492011-153492033 CAGACAGGGAGCAGGAGGTGGGG - Intronic
1200212091 X:154351248-154351270 CACCCAGGTGGCAGGAAGGGAGG + Intronic
1200686686 Y:6265118-6265140 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1200827127 Y:7657448-7657470 CAGCCAGGAGGCAGGGCATGGGG + Intergenic
1200829848 Y:7679338-7679360 CAGCCAGGATTCAGGACATGGGG + Intergenic
1200954612 Y:8930940-8930962 CAGCCAGGAGGCAGGGAATGGGG - Intergenic
1200958449 Y:8973597-8973619 CAGTCAGGAGGCAGGGCATGGGG - Intergenic
1200989564 Y:9336034-9336056 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1200992235 Y:9356367-9356389 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1200994884 Y:9376645-9376667 CAGCCAGGAGGCAGGGGATGGGG - Intronic
1200997549 Y:9396991-9397013 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1201000061 Y:9465527-9465549 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1201002722 Y:9485837-9485859 CAGCCAGGAGGCAGGGGATGGGG - Intronic
1201005377 Y:9506121-9506143 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1201008040 Y:9526450-9526472 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1201010655 Y:9546640-9546662 CAGCCAGGAGGCAGGGTATGGGG - Intergenic
1201063883 Y:10070593-10070615 CAGCCAGGAGGCAGGGGATGGGG + Intergenic
1202109593 Y:21406151-21406173 CAGCCAGGATTCAGGACATGGGG + Intergenic
1202115477 Y:21466709-21466731 CAGCCAGGAGGCAGGGGATGGGG - Intergenic
1202195275 Y:22294519-22294541 CAGCCAGGAGGCAGGGAATGGGG + Intergenic