ID: 1152670284

View in Genome Browser
Species Human (GRCh38)
Location 17:81600045-81600067
Sequence CCTCATGAAGTGTGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152670280_1152670284 -9 Left 1152670280 17:81600031-81600053 CCACTTGAAGCAGTCCTCATGAA 0: 1
1: 0
2: 0
3: 27
4: 490
Right 1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 181
1152670278_1152670284 20 Left 1152670278 17:81600002-81600024 CCAGCAGGGGTGCGGCTGGGGTC 0: 1
1: 0
2: 2
3: 43
4: 308
Right 1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 181
1152670279_1152670284 -8 Left 1152670279 17:81600030-81600052 CCCACTTGAAGCAGTCCTCATGA 0: 1
1: 0
2: 0
3: 11
4: 239
Right 1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152670284 Original CRISPR CCTCATGAAGTGTGGCTGGA AGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900527869 1:3137948-3137970 GCTCTTGGACTGTGGCTGGAGGG + Intronic
901399748 1:9007580-9007602 GCTCATCAGGTGAGGCTGGAGGG - Intronic
901835791 1:11923202-11923224 CCTCCAGAAGCGTGGCTGCAAGG - Exonic
902380742 1:16051143-16051165 CATCAGGAAATGTGGGTGGAAGG - Intronic
902981644 1:20127482-20127504 CCTCATGAAATCTGGCAGAAGGG + Intergenic
903323145 1:22554441-22554463 CCTCAGAAAATGTGGGTGGATGG + Intergenic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
905093045 1:35445093-35445115 CATCATGCAGTGTGGCTGGGTGG + Intronic
905648470 1:39640446-39640468 CCCCAGGAAGAGAGGCTGGAAGG - Intergenic
906867554 1:49439269-49439291 CATCAGAAAGTGTGGCTAGAAGG + Intronic
910376671 1:86579511-86579533 CCTCATGAACTGTGGCATCAAGG - Exonic
911063623 1:93768722-93768744 TCGCAGGAAGTGGGGCTGGAGGG + Intronic
911794993 1:102064407-102064429 CCTGATGAAGAGTGGGTGGCGGG + Intergenic
911917929 1:103722503-103722525 TCTCATGAAGTGGTGCTGTAGGG + Intronic
915318819 1:155044812-155044834 CCTCAGGAAGTCTGGAGGGAGGG + Intronic
915647834 1:157286468-157286490 CCTCATCAAGTGGGTGTGGAAGG + Intergenic
916241550 1:162644890-162644912 CCTTAAGAAGTGTGGTTGGCTGG - Intronic
917495879 1:175539713-175539735 GCTCATGCAGTGTGATTGGAAGG + Intronic
917499443 1:175573179-175573201 GCTGGTGGAGTGTGGCTGGAGGG - Intronic
919754002 1:201055163-201055185 TCTCATGAAGTGTGGCCCAAGGG - Intronic
920103999 1:203537591-203537613 CCTCAATAAGTGTGGCAGGCAGG + Intergenic
920420886 1:205832568-205832590 CTTCATCAGCTGTGGCTGGAGGG - Intronic
921561624 1:216666068-216666090 ACTCATGAGGTATGGCTGGGTGG - Intronic
922196240 1:223363167-223363189 CCTCCTGAAGTCTGGGTGTATGG + Intronic
1063383630 10:5602270-5602292 CCTCATCAAGTGGGCCTGGGAGG - Intergenic
1063383643 10:5602314-5602336 CCTCATCAAGTGGGCCTGGGAGG - Intergenic
1064840981 10:19591792-19591814 CTTCAAGAAGTGTGGCCGGATGG - Intronic
1064992270 10:21266538-21266560 CCTCATGCAGTGTGGGTGTGGGG - Intergenic
1067204274 10:44200083-44200105 TGTCATCAAGTATGGCTGGAGGG - Intergenic
1069230874 10:66007390-66007412 CCTCATGAAGGGTGGATGGTGGG - Intronic
1071718900 10:88123259-88123281 CCTCCTGCAGTGGGGCTGCAGGG + Intergenic
1073812729 10:107168213-107168235 CCATATGAAGTGGGGTTGGACGG - Intergenic
1077680410 11:4235342-4235364 GCTGATGAAGTGGAGCTGGAAGG - Intergenic
1077684689 11:4280760-4280782 GCTGATGAAGTGGAGCTGGAAGG - Intergenic
1077690505 11:4337170-4337192 GCTGATGAAGTGGAGCTGGAAGG + Intergenic
1079474904 11:20819951-20819973 CCTCCTGAAGTCTGCCTGAAAGG - Intronic
1080260276 11:30342382-30342404 CCTCTTGATGGGTGGGTGGATGG + Intergenic
1081701379 11:45154991-45155013 CTGCAGGGAGTGTGGCTGGAAGG + Intronic
1082160673 11:48884993-48885015 CATCATGTAGTGTGGATGGCAGG - Intergenic
1082161693 11:48895413-48895435 CATCATGTAGTGTGGATGGCAGG + Intergenic
1082167274 11:48963841-48963863 CATCATGTAGTGTGGATGGCAGG + Intergenic
1082236300 11:49822857-49822879 CATCATGTAGTGTGGATGGCAGG - Intergenic
1082239752 11:49857365-49857387 CATCATGTAGTGTGGATGGCAGG - Intergenic
1082242402 11:49886986-49887008 CATCATGTAGTGTGGATGGCAGG + Intergenic
1082609793 11:55282733-55282755 CATCATGTAGTGTGGATGGCAGG - Intergenic
1084166564 11:67377558-67377580 CCTCAAGAAGTGTGGCTGGCTGG + Intronic
1088167900 11:106959907-106959929 CCTAATGAAGTTTGCCTGGTGGG + Intronic
1088231391 11:107676943-107676965 CCTCTTGAAGAATGGTTGGAAGG + Intergenic
1088460980 11:110082632-110082654 CCTCATGAGGCGTGGTTGTAAGG - Intergenic
1088940751 11:114453454-114453476 CCTCCTGAGGAGTGGTTGGAAGG - Intergenic
1091409088 12:227493-227515 CCTCGTCTAGCGTGGCTGGAAGG + Intronic
1094839670 12:34337672-34337694 CCTGCTCATGTGTGGCTGGAGGG - Intergenic
1100025731 12:90125575-90125597 CCTAATGAAGTGTAGTTGGTGGG + Intergenic
1100383084 12:94080048-94080070 GCACATGAAGTGTGGGAGGATGG + Intergenic
1100665362 12:96746308-96746330 CCTTAAGGAGTCTGGCTGGAAGG - Intronic
1102001535 12:109560864-109560886 TCTGTTGATGTGTGGCTGGATGG + Intronic
1103505238 12:121438602-121438624 CCTCATGAAGTTTTGGTGGCAGG - Intronic
1104728887 12:131094363-131094385 CCTTATGAAGAGTGAATGGAAGG - Intronic
1112439131 13:99412860-99412882 CCTCAGGATGGGTGGATGGATGG + Intergenic
1113058832 13:106299208-106299230 CCTCAGGATGTGGTGCTGGATGG - Intergenic
1113638922 13:111943516-111943538 CCTCAGGCAGTGTGGCGGGCAGG - Intergenic
1113878633 13:113609799-113609821 CCTCAGGCAGTGGGGCTGGGGGG - Intronic
1119172817 14:72547554-72547576 CCTCCTGCAGTGTGGCTAAATGG + Intronic
1121210857 14:92207221-92207243 CCTGAGGGAGTTTGGCTGGAGGG + Intergenic
1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG + Intronic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1127184976 15:56469457-56469479 CCTAGAGAAGTGTGTCTGGAGGG + Intergenic
1127387811 15:58481200-58481222 CCTCATGACTTGTGGTGGGAGGG + Intronic
1127672764 15:61211713-61211735 ACTCAAGTAGTGTGGCGGGAGGG - Intronic
1128388766 15:67168710-67168732 TCTCATTAAGTGTGCCTGCAGGG + Intronic
1132246226 15:100298292-100298314 CATCCTCAAATGTGGCTGGAAGG - Intronic
1132806386 16:1777001-1777023 CGCCCTGGAGTGTGGCTGGAAGG + Exonic
1132951433 16:2564503-2564525 ACCCATGAAGTGTGTCTGGGAGG - Intronic
1132962917 16:2635667-2635689 ACCCATGAAGTGTGTCTGGGAGG + Intergenic
1134531657 16:14988843-14988865 CCTCCAGAAGAGTGGCTGCAAGG - Intronic
1136474636 16:30505165-30505187 CCTCATGAAGGAGAGCTGGAGGG - Intronic
1140685032 16:77425310-77425332 CATCAGGAATTGAGGCTGGAGGG + Intronic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142123135 16:88396901-88396923 CCTCATGAAGGGAGGCCGGGAGG + Intergenic
1142237092 16:88927498-88927520 CCTCATGAAGGGTTGCAGGGAGG - Intronic
1142807310 17:2378102-2378124 ACTCATGAACTGTGGCTGCCTGG + Intronic
1143255280 17:5553181-5553203 CTTCATGAAGTGAGGTTTGAGGG - Intronic
1143409168 17:6698159-6698181 ACGCATGCAGTGTGGCTGGCCGG - Intronic
1144457844 17:15433470-15433492 CCACATGGAGTGAGGCTGCAGGG + Intergenic
1144832967 17:18141955-18141977 CCTCCTGGAGCGGGGCTGGAGGG - Intronic
1144874640 17:18391012-18391034 CCCCAGGAAGGGTGGGTGGAGGG - Intergenic
1145157585 17:20553409-20553431 CCCCAGGAAGGGTGGGTGGAGGG + Intergenic
1146845399 17:36178970-36178992 CCCCAGGAAGGGTGGGTGGAGGG + Intronic
1146873614 17:36390813-36390835 CCCCAGGAAGGGTGGGTGGAGGG + Intronic
1146880973 17:36441901-36441923 CCCCAGGAAGGGTGGGTGGAGGG + Intergenic
1147065774 17:37922060-37922082 CCCCAGGAAGGGTGGGTGGAGGG - Intergenic
1149848514 17:60021462-60021484 CCCCAGGAAGCGTGGGTGGAGGG + Intergenic
1149861655 17:60125062-60125084 CCCCAGGAAGCGTGGGTGGAGGG - Intergenic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1152706424 17:81845977-81845999 GCTCATCAGGTGGGGCTGGAGGG + Exonic
1154226863 18:12513096-12513118 CCTCATGAAGTCTAGAGGGAAGG - Intronic
1155350865 18:24904736-24904758 CCTCATGAAATGAGTCAGGAAGG - Intergenic
1155547686 18:26931696-26931718 CCTCCTGAAGCAAGGCTGGAGGG + Intronic
1157335887 18:46737041-46737063 CCTCATGCAGTGTGAGTGGGTGG - Intronic
1157474391 18:48012074-48012096 ACCCAGGAAGTGTTGCTGGATGG + Intergenic
1158443048 18:57494292-57494314 CCTCCTTAAGTGGGGCTAGAAGG + Intergenic
1164762832 19:30740719-30740741 CCACATGAATTATTGCTGGAAGG + Intergenic
1164827044 19:31291401-31291423 CCTCATGAAGAGTGCTGGGAAGG - Intronic
1166760007 19:45218305-45218327 CTTGTTGAAGTGTGGCTGGCAGG + Exonic
1167503000 19:49857822-49857844 CCTCACGGACTGTGGCTGGGAGG + Intronic
925001584 2:407071-407093 GCTCCTGGGGTGTGGCTGGAAGG + Intergenic
925715418 2:6780475-6780497 CTCCATCATGTGTGGCTGGAAGG + Intergenic
933255070 2:80071570-80071592 CCACTTGATGTGTGGTTGGAGGG + Intronic
934589161 2:95530755-95530777 CATCATGTAGTGTGGATGGTGGG - Intergenic
936515129 2:113176471-113176493 GCTCAAGAAGAGTGGCTGGTTGG + Intronic
936808076 2:116361486-116361508 CCTCATAAAGTGTGTTAGGAAGG - Intergenic
939733185 2:145810670-145810692 GATCAGGCAGTGTGGCTGGAGGG - Intergenic
940565406 2:155353881-155353903 CCTCCTTAAGTGGGGCAGGATGG - Intergenic
941696096 2:168552535-168552557 AAGCATGAAGTGTGTCTGGAGGG + Intronic
941936927 2:170989444-170989466 CATCATGCAGAGTGGCTGCAAGG - Intergenic
942951668 2:181728821-181728843 CCTCATGAAGGGAGGCTGATGGG - Intergenic
948037724 2:234872840-234872862 CCTGAGGAGGTGTGGCTGGAAGG + Intergenic
949017825 2:241723413-241723435 CCTCAAGGAGTGTGGCTGGCTGG + Intronic
1168894040 20:1311670-1311692 TCTCAAGAAGTGTGGCTGGCTGG + Intronic
1168919452 20:1518883-1518905 CTTCAGGAAGTGTGGGAGGAAGG - Intergenic
1169453481 20:5732133-5732155 TCTCATGAACTGTGGCAGGCTGG - Intergenic
1169783353 20:9332517-9332539 GCTCATCAACTGTGGCTGAAAGG - Intronic
1170241906 20:14175372-14175394 GCTAATGAAGTGTGGAGGGAGGG + Intronic
1170241913 20:14175433-14175455 GCTAATGAAGTGTGGAGGGAGGG + Intronic
1172008314 20:31832115-31832137 CCTCATGAAGAGGCGCTGGAAGG + Exonic
1172690032 20:36783902-36783924 CCTCTGGACGTGGGGCTGGATGG - Exonic
1173209460 20:41020861-41020883 CCTCATTGAGTGTTGCAGGAAGG + Intergenic
1174505896 20:51017404-51017426 CCACATGGAGGGTGCCTGGAAGG + Intronic
1174597025 20:51692474-51692496 TCACGTGAAGTGGGGCTGGAGGG + Intronic
1184843028 22:47063590-47063612 CCTCCTCAGGTGTGACTGGAGGG - Intronic
950494326 3:13324554-13324576 CATCCAGAAGTGAGGCTGGAGGG - Intronic
950547735 3:13648553-13648575 CCACAGCCAGTGTGGCTGGAGGG + Intergenic
953372298 3:42399218-42399240 CTTCATGCAGTGTGGGTGGAGGG + Intronic
956113573 3:65896027-65896049 CCTCAAGAAGTGATGCTGCAAGG + Intronic
967977891 3:195045634-195045656 CCGCATGGAGTGAGGGTGGAGGG - Intergenic
969721848 4:8896403-8896425 CCTCCTGAGGTCAGGCTGGAGGG - Intergenic
970304009 4:14712158-14712180 CCATATGAAGGGTGACTGGATGG - Intergenic
970370439 4:15400620-15400642 GGTCATGAGGTCTGGCTGGAAGG - Intronic
970884959 4:20977469-20977491 CCTGATGATATTTGGCTGGAGGG + Intronic
971028148 4:22608417-22608439 CCTCCTGAAGCAAGGCTGGAGGG + Intergenic
971403218 4:26295526-26295548 CCTGATGAGATGTGACTGGAAGG + Intronic
971425311 4:26509810-26509832 CATCACGAAGTGTGGCTGCAAGG - Intergenic
973864069 4:55094297-55094319 CCTGAGGAAGTATGGTTGGAAGG + Intronic
976440240 4:85064980-85065002 CTGGATGAAGTGTGCCTGGAGGG + Intergenic
981008116 4:139896567-139896589 CCTCATTTAGTGTGGCTTGATGG + Intronic
985641033 5:1063645-1063667 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641050 5:1063694-1063716 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
985641067 5:1063743-1063765 CCTCGTGAGGTGGGGGTGGAGGG - Intronic
986734100 5:10655436-10655458 CGTCATGTAGTGTGGCCGGTGGG - Intergenic
989456650 5:41651565-41651587 GCTAATTAAGTGTGTCTGGAAGG + Intergenic
990960201 5:61385942-61385964 CCTCAAGAAGTGTGGCTATTGGG - Intronic
991045854 5:62221903-62221925 AGTGAGGAAGTGTGGCTGGAAGG - Intergenic
998129406 5:139643696-139643718 CTTCCTGAAGTGTGGCAGGGAGG + Intergenic
998220198 5:140271610-140271632 TCTCCTGGAGTGTGGGTGGAGGG + Intronic
1001307824 5:170588622-170588644 CTTCCTGAAGTGTGGCTGCTGGG + Intronic
1002051303 5:176573158-176573180 GCTCAGCCAGTGTGGCTGGAGGG + Intronic
1003266406 6:4568354-4568376 CCACATGCCGTGAGGCTGGAGGG - Intergenic
1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG + Intergenic
1007640275 6:43332909-43332931 GCTTATGAAGTCTGGCTGGAAGG + Intronic
1007840673 6:44713406-44713428 GCTCTAGAAGTGTGGCTAGAAGG + Intergenic
1008092371 6:47307140-47307162 CATCCTGAAGGGTGACTGGAGGG - Intronic
1013416966 6:109934009-109934031 CCTCATGGAGTGCTGCCGGAGGG + Intergenic
1014832118 6:126115124-126115146 CCTCCTGAAGGGTGGCTGGAAGG - Intergenic
1018059305 6:160078270-160078292 CCTGATGAAGTGAGGATGGATGG + Exonic
1018712845 6:166509030-166509052 ACAAAGGAAGTGTGGCTGGAAGG + Intronic
1018715807 6:166532104-166532126 GCCCATGCAGTATGGCTGGAGGG + Intronic
1019874317 7:3795362-3795384 CCTCCTGCAGTATTGCTGGAAGG + Intronic
1023712700 7:43011890-43011912 CCTCTTGAAGGGTGGATGGTGGG - Intergenic
1026428788 7:70323393-70323415 CCTCATGAAGTGGTATTGGAAGG + Intronic
1030313986 7:108095540-108095562 CCTCATGTAGTTTTACTGGATGG + Intronic
1031041835 7:116846686-116846708 CCAGATGAAATGTGGTTGGAGGG - Intronic
1034402044 7:150868776-150868798 CCTGTTGCAGTGTGGTTGGAAGG - Intergenic
1035566163 8:642901-642923 CCTCAGGCTGTGGGGCTGGACGG + Intronic
1037281229 8:17244881-17244903 CCTGATGGATTTTGGCTGGAGGG + Intronic
1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG + Intronic
1042089961 8:65148156-65148178 CCTCATGGAGGGTAGCTGTAGGG - Intergenic
1044314270 8:90731266-90731288 CCTCATGAAATGAGTCAGGAAGG + Intronic
1047357112 8:124132966-124132988 CCTCATGAAATGTGTTAGGAAGG - Intergenic
1048877241 8:138846597-138846619 CCCCAGGAAGGCTGGCTGGAGGG - Intronic
1051372239 9:16368449-16368471 CAACAGGCAGTGTGGCTGGATGG + Intergenic
1053056608 9:34996692-34996714 AGTCATCAAGCGTGGCTGGAAGG + Exonic
1055349825 9:75375046-75375068 ACCCATCCAGTGTGGCTGGATGG - Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057968020 9:99523478-99523500 CCCTATGAAGTGTGGCCAGAAGG + Intergenic
1059417440 9:114170559-114170581 ACTCATTAAGTGTGTTTGGAAGG - Intronic
1059424932 9:114215085-114215107 CCTCATGCAGTGAGTCCGGAGGG + Intronic
1060292649 9:122318556-122318578 CCTCAGGAAGGATGGCTGGTAGG + Intronic
1060422652 9:123480378-123480400 TGTCAAGAGGTGTGGCTGGAGGG - Intronic
1060960362 9:127676467-127676489 ACTCAGGCAGAGTGGCTGGAGGG + Intronic
1062027029 9:134345293-134345315 GCTCATGAAGTGTAGCTGCTGGG + Intronic
1189003112 X:36966155-36966177 GCTTATGAAGTGTGGAAGGATGG - Intergenic
1190218398 X:48495255-48495277 CCTCATGGACTGGGACTGGAAGG + Intergenic
1193424464 X:81325309-81325331 CCTCTTAAAGTGAGGCTGAACGG + Intergenic
1197723858 X:129762607-129762629 CCTACTGATGAGTGGCTGGAGGG - Intronic
1197923495 X:131621510-131621532 CCTCTTATAGTGTTGCTGGAAGG + Intergenic