ID: 1152673813

View in Genome Browser
Species Human (GRCh38)
Location 17:81626220-81626242
Sequence CGGGGTTCAAGCGGTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1339
Summary {0: 1, 1: 0, 2: 13, 3: 316, 4: 1009}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152673813_1152673824 28 Left 1152673813 17:81626220-81626242 CCAGGAAAACCGCTTGAACCCCG 0: 1
1: 0
2: 13
3: 316
4: 1009
Right 1152673824 17:81626271-81626293 GCGCCACTGCACTCCAGCCTGGG 0: 47841
1: 174825
2: 232776
3: 176871
4: 95097
1152673813_1152673823 27 Left 1152673813 17:81626220-81626242 CCAGGAAAACCGCTTGAACCCCG 0: 1
1: 0
2: 13
3: 316
4: 1009
Right 1152673823 17:81626270-81626292 CGCGCCACTGCACTCCAGCCTGG 0: 27510
1: 122628
2: 238905
3: 218800
4: 128299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152673813 Original CRISPR CGGGGTTCAAGCGGTTTTCC TGG (reversed) Intronic
900170322 1:1264812-1264834 CCAGGTTCAAGCGATTCTCCTGG - Exonic
900219777 1:1501970-1501992 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
900240165 1:1612955-1612977 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
900254162 1:1688504-1688526 CTGGGTTCAAGCGATTCTCCTGG - Intronic
900262879 1:1741446-1741468 CTGGGTTCAAGCGATTCTCCTGG - Intronic
900327981 1:2119878-2119900 CCAGGTTCAAGCGATTCTCCTGG + Intronic
900676340 1:3888898-3888920 CCGGGTTCAAGCGATTCTCCAGG - Intergenic
900692473 1:3988882-3988904 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
901371779 1:8805102-8805124 CCAGGTTCAAGCGATTGTCCCGG + Intronic
901469168 1:9443723-9443745 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
901531281 1:9854272-9854294 CCAGGTTCAAGCGATTCTCCTGG - Intronic
901567430 1:10130165-10130187 CTGGGTTCAAGCGATTCTCTTGG + Intronic
901599725 1:10413960-10413982 CTGGGTTCAAGCGATTCTCATGG - Intronic
901689262 1:10961851-10961873 CTGGGTTCAAGCGATTCTCATGG - Intronic
901782862 1:11605582-11605604 CCGGGTTCAAGCGATTCCCCTGG - Intergenic
901820420 1:11825714-11825736 CTGGGTTCAAGCGATTCTCCTGG + Intronic
901889210 1:12247795-12247817 CCGGATTCAAGCGATTCTCCTGG + Intronic
901943128 1:12679169-12679191 CTGGGTTCAAGCAATTTTCCTGG + Intergenic
901958962 1:12809700-12809722 CCGGGTTCAAGTGATTATCCTGG + Intergenic
902006137 1:13233720-13233742 CTGGGTTCAAGCGATTTTCCTGG + Intergenic
902419141 1:16263902-16263924 CCAGGTTCAAGCGATTCTCCTGG + Intronic
902428904 1:16346846-16346868 CTGGGTTCAAGTGATTCTCCTGG + Intronic
902520389 1:17012314-17012336 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
902897641 1:19489900-19489922 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
902946195 1:19841488-19841510 CTGGGTTCAAGCGATTCTTCTGG - Intergenic
902947854 1:19855542-19855564 CCGGGTTCAAGCAATTATCCTGG + Intergenic
903198493 1:21712720-21712742 CTGGGTTCAAGCAATTCTCCTGG + Intronic
903483277 1:23670153-23670175 CTGAGTTCAAGCGATTCTCCTGG - Intergenic
903485054 1:23683766-23683788 CCCGGTTCAAGCGATTCTCCTGG + Intergenic
903984462 1:27215660-27215682 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
904085910 1:27907940-27907962 CCGGGCTCAAGCGATTCTCCTGG + Intronic
904181134 1:28667548-28667570 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
904217974 1:28939535-28939557 CCGGGTTCAAGCGATTCTCCTGG + Intronic
904467594 1:30717746-30717768 CCGGGTTCACGCCGTTTTCCTGG + Intronic
904497781 1:30896867-30896889 CCGGGTTCAAGCAATTCTCCTGG - Intronic
905062499 1:35151755-35151777 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
905108607 1:35578332-35578354 CCGGGTTCAAGCGATTCCCCTGG - Intronic
905571495 1:39009824-39009846 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
905671492 1:39793517-39793539 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
905725365 1:40246695-40246717 TGGGGTTCAAGCGATTCTCCTGG - Intronic
906145085 1:43555537-43555559 CTGGGTTCAAGCGATTCTCCTGG + Intronic
906414499 1:45610103-45610125 CCGGGTTCAAGCGATTCTTCTGG - Intronic
906438349 1:45816769-45816791 CCAGGTTCAAGCGATTCTCCTGG + Intronic
906921627 1:50070645-50070667 CTGGGTTCAAGCGATTCTCCTGG - Intronic
907017792 1:51034240-51034262 CCGGGTTCAAGCAATTCTCCCGG + Intergenic
907073832 1:51561141-51561163 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
907202606 1:52740655-52740677 CGGGGTTCAAGCAATTCTCATGG + Intronic
907215468 1:52859769-52859791 CCGGGTTCAAGTGATTCTCCTGG + Intronic
907225407 1:52941639-52941661 CTGGGTTCAAGCCATTCTCCTGG - Intronic
908123446 1:61007196-61007218 CCGGGTTCAAGCCATTCTCCTGG + Intronic
908195995 1:61746030-61746052 CTGGGTTCAAGCGATTGTCCTGG + Intronic
908311643 1:62890223-62890245 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
908344357 1:63216521-63216543 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
908345123 1:63224774-63224796 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
908530230 1:65027138-65027160 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
909132733 1:71759389-71759411 CCGGGTTCAAGTGATTCTCCTGG + Intronic
910207486 1:84762573-84762595 CCGGGTTCAAGCGATTCTCGTGG + Intergenic
910696633 1:90025388-90025410 CCGGGTTCAAACGATTCTCCTGG + Intronic
910962057 1:92773110-92773132 CTGGGTTCAAGAGATTCTCCTGG - Intronic
911897571 1:103456681-103456703 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
911925889 1:103832091-103832113 CTGGGTTAAAGTGATTTTCCTGG - Intergenic
912363386 1:109113297-109113319 CCGGGTTCAAGAGATTCTCCTGG - Intronic
912458186 1:109813346-109813368 CCAGGTTCAAGTGGTTCTCCTGG + Intergenic
912584902 1:110753568-110753590 CCGGGCTCAAGCGATTCTCCTGG + Intergenic
912821978 1:112875011-112875033 CTGGGTTCAAGCTATTCTCCTGG - Intergenic
912920938 1:113866415-113866437 CCGGGTTCAAGCTATTCTCCTGG - Intronic
913087900 1:115456298-115456320 CGAGGTATAAGCAGTTTTCCAGG - Intergenic
913722069 1:121606472-121606494 CTGGGCTCAAGCGATTCTCCTGG - Intergenic
913741853 1:121854053-121854075 CTGGGCTCAAGCGATTCTCCTGG - Intergenic
914734928 1:150406806-150406828 CTGGGTTCAAGTGATTCTCCTGG + Intronic
914796554 1:150924914-150924936 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
914803423 1:150975766-150975788 CAGGGTTCAAGCGATTCTCGTGG - Intergenic
914861094 1:151386842-151386864 CGGGGTTCAAGCAATTCTCCTGG + Intergenic
915119782 1:153622275-153622297 CCAGGTTCAAGCGATTTTCCTGG - Intronic
915168356 1:153961180-153961202 CTGGGTTCAAGTGATTCTCCTGG - Intronic
915191167 1:154151994-154152016 CCAGGTTCAAGCGATTCTCCTGG - Intronic
915364607 1:155307859-155307881 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
915426352 1:155830369-155830391 CCGGGTTCAAGAGATTCTCCTGG + Intronic
915892984 1:159788734-159788756 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
916092377 1:161317653-161317675 CTGGGTTCAAGCGATTCTCCTGG + Intronic
916216647 1:162400853-162400875 CCTGGTTCAAGCGATTCTCCTGG - Intronic
916481101 1:165215215-165215237 CCGGATTCAAGCGATTCTCCTGG - Intronic
916555144 1:165888383-165888405 TTGGGTTCAGGCGATTTTCCTGG + Intronic
916904069 1:169262656-169262678 CCGTGTTGAAGAGGTTTTCCTGG - Intronic
917074482 1:171189750-171189772 CCGGGTTCAAGCGATTTAGCTGG + Intronic
917110694 1:171544215-171544237 CTGGGTTCAAGCATTTCTCCTGG + Intronic
917858313 1:179120516-179120538 CTGGGCTCAAGCGATTCTCCTGG + Intronic
917938840 1:179895823-179895845 CCGGGTTCAAGTGATTCTCCCGG - Intronic
918236828 1:182589212-182589234 CGGGCTGCAAGCAGTCTTCCAGG - Exonic
918460058 1:184767334-184767356 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
918623914 1:186636332-186636354 CCAGGTTCAAGCAGTTCTCCTGG - Intergenic
919608196 1:199712493-199712515 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
919609490 1:199727460-199727482 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
919634465 1:199990057-199990079 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
919822412 1:201481601-201481623 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
920250685 1:204620365-204620387 CTGGATTCAAGCGATTCTCCTGG + Exonic
920632411 1:207665488-207665510 CAGGGTTCAAGCAATTCTCCTGG + Intronic
921018211 1:211211832-211211854 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
921068658 1:211641022-211641044 CCCGGTTCAAGCGATTCTCCTGG - Intergenic
921144829 1:212344063-212344085 CCAGGTTCAAGCGATTCTCCTGG + Intronic
921635489 1:217487517-217487539 CCGGGTTCAGGCGATTCTCCTGG + Intronic
921674266 1:217960793-217960815 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
922452506 1:225748318-225748340 CCGGGTTCAAGCGATTCCCCTGG + Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
923111130 1:230891018-230891040 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
923717093 1:236434329-236434351 CTGGGTTCAAGCAATTTTCCTGG + Intronic
923807048 1:237268840-237268862 CTGGGTTCAAGCCATTCTCCTGG - Intronic
924593493 1:245425498-245425520 CCAGGTTCAAGCGATTTTCCTGG + Intronic
924602663 1:245505030-245505052 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1063311924 10:4960723-4960745 CTGGGTTCAAGCTATTTTCCGGG + Intronic
1063315956 10:5006507-5006529 CCAGGTTCAAGCTATTTTCCTGG - Intronic
1063466883 10:6251872-6251894 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1064046043 10:12016598-12016620 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1064057321 10:12108371-12108393 TTGGGTTCAAGCGATTCTCCTGG + Intronic
1064075078 10:12262216-12262238 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1064182864 10:13134524-13134546 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1064219544 10:13428895-13428917 CTGGGTTCAAGCGATTGTCCTGG + Intergenic
1064243530 10:13651577-13651599 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1064261086 10:13787214-13787236 CGGAGCTCACGGGGTTTTCCAGG - Intronic
1064390032 10:14934232-14934254 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1064394025 10:14966155-14966177 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1064399064 10:15005589-15005611 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1064440351 10:15348069-15348091 CTGGGTTCAAGCGAGTCTCCTGG + Intronic
1064441108 10:15354400-15354422 CCGGGTTCAAGCAGTTCTCCTGG - Intronic
1064625898 10:17261001-17261023 CTAGGTTCAAGCGATTCTCCTGG + Intergenic
1064681469 10:17814777-17814799 CTGGGTTCAAGTGATTCTCCAGG + Intronic
1064763445 10:18646099-18646121 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1064773369 10:18748846-18748868 CCGAGTTCAAGCGATTCTCCTGG + Intergenic
1065378115 10:25062950-25062972 CCGGGTTCAAGCTATTCTCCTGG + Intergenic
1065567117 10:27023246-27023268 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1065703311 10:28446242-28446264 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1065736371 10:28756453-28756475 CCGGTTTCAAGCGATTCTCCTGG + Intergenic
1065830599 10:29610542-29610564 CTGGGTTTAAGCAGTTCTCCAGG + Intronic
1065929917 10:30470397-30470419 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1066388723 10:34962117-34962139 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1066553687 10:36587240-36587262 CTGGGTTTAAGCGATTCTCCTGG - Intergenic
1066635415 10:37494734-37494756 CTGGGTTCAAGCGATTCCCCTGG + Intergenic
1066870164 10:40493515-40493537 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1067110814 10:43398432-43398454 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1067302427 10:45024202-45024224 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1068033930 10:51736700-51736722 CTGGTTTCAAGCGGTCCTCCTGG + Intronic
1068382424 10:56273992-56274014 CCGGGTTCACGCCGTTCTCCTGG - Intergenic
1068780255 10:60912325-60912347 CTGGGTTCAAGCGATTCGCCTGG + Intronic
1069411774 10:68161419-68161441 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1069454144 10:68540500-68540522 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1069494190 10:68888192-68888214 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1069603292 10:69723435-69723457 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1069770737 10:70898087-70898109 CTGGGTTCAAGCAGTTCTCCTGG - Intergenic
1070021940 10:72595356-72595378 CTGAGTTCAAGCGATTCTCCTGG - Intronic
1070264997 10:74893561-74893583 TGGGGTTCAAGCGATTCTCCTGG + Intronic
1070613890 10:77954077-77954099 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
1070623284 10:78030595-78030617 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1070623531 10:78032372-78032394 CCGGATTCAAGCGATTCTCCTGG - Intergenic
1071580217 10:86762450-86762472 CTGGGTTCAAGTGATTATCCTGG + Intronic
1071866239 10:89735629-89735651 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1072041950 10:91614901-91614923 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1072106409 10:92278692-92278714 CCGGGTTCAAGCCATTCTCCTGG + Intronic
1072194580 10:93105994-93106016 CCGAGTTCAAGCGATTCTCCTGG + Intergenic
1072655212 10:97325137-97325159 CTGGGTTCAAGCGATTTTCCTGG - Intergenic
1073244188 10:102077867-102077889 CTGGGTTCAAGGGATTCTCCTGG - Intergenic
1073400981 10:103257492-103257514 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1073416087 10:103383670-103383692 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1073757791 10:106599272-106599294 CTGGGTTCAAGTGATTTTTCTGG - Intronic
1073882384 10:107998127-107998149 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1074151164 10:110761000-110761022 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1074274314 10:111987047-111987069 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1074306243 10:112281161-112281183 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1074514965 10:114158612-114158634 CTGGGATCAAGTGCTTTTCCTGG - Intronic
1074582263 10:114731232-114731254 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1074877697 10:117626975-117626997 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1075036140 10:119068877-119068899 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1076432062 10:130411004-130411026 CTGGGTTCAAGCGATTTTCCTGG - Intergenic
1076918234 10:133437003-133437025 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1076983043 11:215313-215335 CCGGGTTTAAGCGATTCTCCTGG - Intergenic
1077054157 11:582356-582378 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1077715439 11:4575599-4575621 CAAGGTTCGAGCGATTTTCCTGG + Intronic
1077864107 11:6209080-6209102 CTGGGTTCAAGTGATTGTCCTGG - Intronic
1077957351 11:7035225-7035247 CTGGGTTCAAGCGATTCTCATGG - Intronic
1078055766 11:8007888-8007910 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1078212574 11:9282282-9282304 CTGGGTTCAAGCGATTCTCCTGG - Exonic
1078306613 11:10194602-10194624 CCGAGTTCAAGCGATTCTCCTGG + Intronic
1078506614 11:11954361-11954383 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1078590308 11:12635276-12635298 CAGGGTTCAAGTGATTCTCCTGG - Intergenic
1078592069 11:12650109-12650131 CTGGGTTCAAGCGATTCTCCCGG - Intergenic
1078606415 11:12780335-12780357 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1078887105 11:15512377-15512399 CCGGGTTCAAGCGATTCTCATGG - Intergenic
1079034078 11:17007414-17007436 CTGGGTTCAAGCGTTCCTCCTGG + Intronic
1079078740 11:17399180-17399202 CCGGGTTCAAGCAATTATCCTGG - Intronic
1079087313 11:17455843-17455865 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1079180281 11:18187340-18187362 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1079287855 11:19155485-19155507 CTGGGTTCAAGCGATTCTCTTGG - Intronic
1079441947 11:20523938-20523960 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1079624693 11:22602003-22602025 CCGGGTTCAAGGGATTCTCCTGG - Intergenic
1080721472 11:34853454-34853476 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1081107467 11:39088463-39088485 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1081256173 11:40898258-40898280 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1081506390 11:43721523-43721545 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1081835139 11:46147233-46147255 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1081852648 11:46284558-46284580 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1082010279 11:47445500-47445522 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1082017962 11:47506331-47506353 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1082024186 11:47559906-47559928 TTGGGTTCAAGCGATTCTCCTGG - Intronic
1082747367 11:56979634-56979656 CCGGGTTCAAGGGATTCTCCTGG - Intergenic
1082849916 11:57755225-57755247 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1082856232 11:57809801-57809823 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1082860861 11:57855060-57855082 CTGGGTTCAAGCGATTCTCGTGG + Intergenic
1083230023 11:61311156-61311178 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1083652817 11:64213147-64213169 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1083793486 11:65001043-65001065 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1083929913 11:65835823-65835845 CGGGGTTCAAGTGGTTTAGAGGG + Intronic
1084046207 11:66569034-66569056 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1084311714 11:68320553-68320575 CCGGGTTCCAGCTGTTCTCCTGG + Intronic
1084503560 11:69551546-69551568 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1084570315 11:69955785-69955807 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1084883094 11:72186022-72186044 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1084914567 11:72418759-72418781 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1084991647 11:72931186-72931208 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1085092405 11:73729190-73729212 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1085307368 11:75495171-75495193 CCGGGTTCAAGCGACTCTCCTGG - Intronic
1085413259 11:76304158-76304180 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1085425663 11:76402457-76402479 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1086318568 11:85619738-85619760 CTGGGTTCAGGCGATTCTCCTGG - Intronic
1086406681 11:86504782-86504804 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1088248960 11:107845857-107845879 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1088456131 11:110034693-110034715 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1088611153 11:111578296-111578318 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1088678073 11:112215613-112215635 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1088686072 11:112285488-112285510 CCGGGTTCAAGGGATTCTCCTGG + Intergenic
1088862501 11:113814956-113814978 CCGGGTTCAGGCGATTTTCATGG - Intronic
1089445428 11:118548456-118548478 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1089445585 11:118549616-118549638 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1089486898 11:118853576-118853598 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1089514273 11:119022076-119022098 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1089520630 11:119060631-119060653 CCGGGCTCAAGCGATTCTCCTGG + Intergenic
1089578323 11:119462445-119462467 CTGGGTTCAAGCGACTGTCCTGG + Intergenic
1089950294 11:122519406-122519428 CTGGGTTCAAGCAGTTTCCCTGG - Intergenic
1090349606 11:126099364-126099386 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1091411880 12:246222-246244 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1091553968 12:1558124-1558146 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1091726656 12:2851071-2851093 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1092172147 12:6380594-6380616 CCAGGTTCAAGTGATTTTCCTGG - Intronic
1092426759 12:8381469-8381491 CGGGGTTCAAGCAATTCTCGTGG + Intergenic
1092463418 12:8706542-8706564 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1092613315 12:10193837-10193859 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1092747911 12:11690791-11690813 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1093462145 12:19416715-19416737 CTGGGTTCAAGCAATTCTCCGGG + Intronic
1093556629 12:20483293-20483315 CGGGGTTCAAACAATTCTCCTGG - Intronic
1093907760 12:24712896-24712918 CCAGGTTCAAGCTGTTCTCCAGG - Intergenic
1094458369 12:30664831-30664853 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1094619558 12:32067127-32067149 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
1094619867 12:32069834-32069856 CTGGGTTCAAGCGATTCTCATGG + Intergenic
1095271167 12:40221212-40221234 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1095301160 12:40585707-40585729 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1095466358 12:42491457-42491479 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1095900244 12:47320581-47320603 CTGGGTTCAAGAGTTTCTCCTGG + Intergenic
1095954056 12:47796515-47796537 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1096132927 12:49174829-49174851 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1096189453 12:49605850-49605872 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1096224382 12:49856270-49856292 CTGGGTTCAAACGATTCTCCTGG + Intergenic
1096278354 12:50230126-50230148 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1096373122 12:51084708-51084730 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1096684508 12:53278979-53279001 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1096703866 12:53406162-53406184 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1097016609 12:55991831-55991853 CCGGGTTCAAGTGATTATCCTGG - Intronic
1097020109 12:56014701-56014723 CCGGGTTCAAGCAGTTCTCCTGG - Intronic
1097082986 12:56446736-56446758 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1097094143 12:56532123-56532145 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1097106709 12:56630168-56630190 CGGGGTACAAGCGGTTCACATGG + Intronic
1097227400 12:57486361-57486383 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1097386441 12:58955576-58955598 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1097793869 12:63843030-63843052 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1097808113 12:63987626-63987648 CGGGGTTCAAGCGATTCTCCTGG - Intronic
1097853929 12:64442212-64442234 CCGGGTTCAAGCAATTCTCCGGG + Intronic
1098278711 12:68840597-68840619 CCGGGTTCAAGCCATTCTCCTGG + Exonic
1098957502 12:76702776-76702798 CTGGGTTCAAGGGATTCTCCTGG + Intergenic
1099074741 12:78092591-78092613 CCGGGTTCACGCCATTTTCCTGG + Intronic
1099510584 12:83530790-83530812 CTGGGTTCAAGCAGTTCTCCTGG + Intergenic
1099651660 12:85435731-85435753 CTGGGTTCAAGAGATTCTCCTGG - Intergenic
1099951015 12:89303815-89303837 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1100285568 12:93163000-93163022 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1100323935 12:93523535-93523557 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1100350738 12:93779681-93779703 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1100571949 12:95851271-95851293 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1100638601 12:96459576-96459598 CTGGGTACAAGCGATTCTCCTGG + Intergenic
1101169247 12:102072144-102072166 CAGGGTTCAAGCGATTCTCATGG + Intergenic
1101316508 12:103633586-103633608 CCGGGTTCGAGCGATTCTCCCGG - Intronic
1101905174 12:108819297-108819319 CAGGGTTCAGGAGGTGTTCCTGG + Intronic
1101965153 12:109277271-109277293 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1102051176 12:109862956-109862978 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1102052580 12:109873538-109873560 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1102222383 12:111203314-111203336 CTGGGCTCAAGTGATTTTCCTGG - Intronic
1102312741 12:111859741-111859763 CCTGGTTCAAGCGATTCTCCTGG + Intronic
1102371543 12:112385875-112385897 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1102754487 12:115326435-115326457 CTGGGTTCAAACGATTCTCCTGG + Intergenic
1102985070 12:117271369-117271391 CCTGGTTCAAGCGATTCTCCTGG + Intronic
1102993032 12:117328262-117328284 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1103392620 12:120585227-120585249 CCGGGTTCAAGCGATTCTTCTGG + Intergenic
1103401860 12:120648785-120648807 CTGGGTTGAAGCGATTCTCCTGG - Intronic
1103434721 12:120915942-120915964 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
1103525853 12:121567802-121567824 CCGGGTTCAAGCCATTCTCCGGG + Intronic
1103582648 12:121926847-121926869 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1103582968 12:121929769-121929791 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1103588822 12:121976100-121976122 CTAGGTTCAAGCGGTTCTCCTGG + Intronic
1103687334 12:122742536-122742558 CCGGGTTCAAGCAGTTCTCCTGG + Intergenic
1103689297 12:122758163-122758185 CAGGGTTCAAGTGATTCTCCTGG + Intronic
1104115242 12:125743637-125743659 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1104175891 12:126332427-126332449 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1104262423 12:127196715-127196737 TGGGGTTCAAGCCATTCTCCTGG - Intergenic
1104426721 12:128683870-128683892 CTGGGTTCAAGAGATTCTCCTGG - Intronic
1104861088 12:131924074-131924096 CCGGGTTCAAGCGATTCTCCAGG + Intergenic
1105366455 13:19769639-19769661 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1105377653 13:19860217-19860239 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1105473533 13:20712494-20712516 CCGGGTTCAAGCGATTCTCTTGG - Intronic
1105655928 13:22438679-22438701 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1105761053 13:23514729-23514751 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1105933233 13:25071796-25071818 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1106246733 13:27956163-27956185 CTAGGTTCAAGCGATTCTCCTGG - Intergenic
1106274294 13:28189420-28189442 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1106637229 13:31542303-31542325 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1106647355 13:31650616-31650638 CGGGGTTCAAGCGATTCTTCTGG - Intergenic
1107514449 13:41115380-41115402 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1107785376 13:43951525-43951547 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1107893195 13:44932033-44932055 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1108213803 13:48164266-48164288 CTGGGTTCAAGTGATTTTCCTGG + Intergenic
1108625119 13:52220951-52220973 CTGGGTTCAAGCGATTCTACTGG + Intergenic
1108695761 13:52901098-52901120 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1109019799 13:57074545-57074567 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1109310266 13:60684635-60684657 CTGGGTTCAAGCGATTCTCCAGG + Intergenic
1109349207 13:61155451-61155473 CTGGGTTCAAGTGGTCTGCCTGG + Intergenic
1109387268 13:61647399-61647421 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1109752724 13:66717356-66717378 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1110188363 13:72701308-72701330 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1110444616 13:75564787-75564809 CTGGGTTCAAGCGATTCTCATGG + Intronic
1110858261 13:80320436-80320458 CTGGGTTCAAGCGATTCTCATGG - Intergenic
1110995411 13:82101777-82101799 CCGGGTTCAAGCGATTCTTCTGG + Intergenic
1111027586 13:82551804-82551826 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1111062935 13:83046748-83046770 CAGGGTTCAAGCAATTTTCCTGG - Intergenic
1111883956 13:93995279-93995301 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1112269996 13:97959638-97959660 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1112291351 13:98145766-98145788 CTGGGTTCAGGCGATTCTCCTGG - Intronic
1112361022 13:98718713-98718735 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1112460763 13:99601929-99601951 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1113134705 13:107076328-107076350 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1113366503 13:109681513-109681535 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1113800544 13:113084254-113084276 TGGGGTTCAGGAGGTTTTCTGGG - Intronic
1114318634 14:21528042-21528064 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1114347043 14:21807479-21807501 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1114409280 14:22485512-22485534 CTGGGTTTCAGGGGTTTTCCAGG + Intergenic
1114509485 14:23246226-23246248 CAGGGTTCAAGCGATTCTCCTGG + Intronic
1114619819 14:24088737-24088759 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1114759444 14:25296865-25296887 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1115136928 14:30121519-30121541 CTGGGTTCCAGCGATTCTCCTGG + Intronic
1115205597 14:30900263-30900285 CTGGGTTCAAGTGATTCTCCCGG - Intronic
1115250661 14:31343184-31343206 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1115504979 14:34085222-34085244 CTGGGTTCAAGCGACTCTCCTGG - Intronic
1115577094 14:34722493-34722515 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1116019517 14:39443175-39443197 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1116695799 14:48176020-48176042 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1116891594 14:50273982-50274004 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1117005094 14:51413082-51413104 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1117156290 14:52945342-52945364 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1117363558 14:55002362-55002384 CTGGGTTCAAGGGATCTTCCTGG + Intronic
1117392365 14:55273897-55273919 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1117864767 14:60135644-60135666 CTGGGTTCAAGCGATTCTCCTGG + Exonic
1118288305 14:64498404-64498426 CTGGGTTCAAGTGCTTCTCCCGG + Intronic
1118351548 14:64975619-64975641 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1119011221 14:70991296-70991318 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1119091879 14:71790584-71790606 CTGCGTTCAAGCGATTCTCCTGG + Intergenic
1119224042 14:72930360-72930382 CCGGGTTCAAGCGATTGTTCTGG + Intronic
1119240384 14:73054588-73054610 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1119250489 14:73148837-73148859 CTGGGTTCCAGCGATTCTCCTGG - Intronic
1119339235 14:73861969-73861991 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1119370331 14:74135156-74135178 CCGGGTTCAAGCGATTCCCCTGG + Intronic
1119464331 14:74842896-74842918 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1119542234 14:75447749-75447771 TGGGGTTCAAGTGATTCTCCTGG + Intronic
1119739024 14:77001819-77001841 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1120047874 14:79828524-79828546 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1121196817 14:92080625-92080647 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1121216721 14:92254203-92254225 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1121904495 14:97727279-97727301 CTGGGTTCAAGCGATTCTCTTGG + Intergenic
1122164985 14:99816255-99816277 CTGGGCTCAAGCGATTCTCCTGG + Intronic
1122503416 14:102216837-102216859 CTGGGTTCAAGTGATTTTCATGG - Intronic
1122635309 14:103126977-103126999 CGGGGCTGACGCGGCTTTCCCGG + Intronic
1122663497 14:103313155-103313177 CTGGGTTCAAGCGATTCCCCTGG - Intergenic
1122684456 14:103494138-103494160 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1122777566 14:104128168-104128190 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1123776155 15:23582834-23582856 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1124385013 15:29200267-29200289 CCGGGTTCAAGCGATTCTCATGG + Intronic
1124802120 15:32843031-32843053 CTGAGTTCAAGCGATTCTCCTGG - Intronic
1124837153 15:33206189-33206211 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1125287564 15:38110264-38110286 CCCGGTTCAAGCGATTCTCCTGG - Intergenic
1125639051 15:41214417-41214439 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1125909907 15:43426922-43426944 CCTGGTTCAAGTGATTTTCCTGG - Intronic
1125978083 15:43973459-43973481 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1126696164 15:51327573-51327595 CGGGGTTCAAGCGATTCTCAAGG + Intronic
1126770336 15:52049706-52049728 CCGGGTTCGAGCGATTCTCCTGG + Intronic
1126777152 15:52110525-52110547 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1126813225 15:52429593-52429615 CAGGGTTCAAGTGATTCTCCTGG - Intronic
1127438294 15:58979984-58980006 CCGGGTTCAAGCGATTCTTCTGG + Intronic
1127506282 15:59601052-59601074 CCGGGTTCATGCCGTTCTCCTGG + Intronic
1127575569 15:60288393-60288415 CCGGGTTCAAGGGATTTGCCTGG - Intergenic
1127640206 15:60909071-60909093 CAGGGTTCAGGTGGCTTTCCAGG - Intronic
1127688447 15:61371362-61371384 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1127694329 15:61429660-61429682 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1127830339 15:62744638-62744660 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1127835242 15:62785556-62785578 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1127943634 15:63727180-63727202 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1127948797 15:63783970-63783992 CCGGGTTCAAGCCATTCTCCTGG - Intronic
1128037219 15:64537405-64537427 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1128050189 15:64657163-64657185 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1128117781 15:65122240-65122262 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1128140676 15:65298488-65298510 CGGGGTTCATGCGATTCTCCTGG - Intronic
1128484210 15:68068987-68069009 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1128631716 15:69274611-69274633 CAGGGTTCAAGTGATTCTCCTGG - Intergenic
1128819260 15:70637415-70637437 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1128822559 15:70673000-70673022 CCAGGTTCAAGCAGTTCTCCTGG - Intronic
1128829754 15:70756777-70756799 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1129429801 15:75491307-75491329 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1129586420 15:76871664-76871686 CTGGGTTCAAGCAATTCTCCAGG + Intronic
1129620099 15:77136570-77136592 CGAGGTTCAAGCGATTCTCCTGG - Intronic
1129729781 15:77923495-77923517 CTGGGTTCAAGCGATTCTCTTGG - Intergenic
1129983130 15:79892855-79892877 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1130222660 15:82033669-82033691 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1130237111 15:82145738-82145760 TGGGGTTCAAGCAATTCTCCTGG - Intronic
1130242646 15:82210766-82210788 CTGGGTTCAAACGATTCTCCAGG - Intronic
1130298647 15:82664316-82664338 TGGGGTTCAGGGGGCTTTCCTGG - Intronic
1130347394 15:83060698-83060720 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1130423355 15:83770971-83770993 GTGGGTTCAAGCAGTTCTCCTGG - Intronic
1130935985 15:88470862-88470884 GTGGGTTCAAGAGGTTTTCGAGG + Intronic
1131146048 15:90013192-90013214 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1131280383 15:91016475-91016497 CCGGGTTCAAGCGATTCGCCTGG + Intronic
1131490935 15:92862207-92862229 CAGGGTTCAAGCAATTCTCCTGG + Intergenic
1132344172 15:101097878-101097900 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1132437574 15:101821746-101821768 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1132878904 16:2152597-2152619 CTGGGTTCAAGCTATTCTCCTGG - Intronic
1132893026 16:2213937-2213959 CGGGGTTGATGCCGTATTCCTGG + Exonic
1133075514 16:3277603-3277625 CTGAGTTCAAGCCGATTTCCAGG + Intronic
1133216550 16:4296052-4296074 CCTGGTTCAAGCGATTCTCCTGG + Intergenic
1133524870 16:6594880-6594902 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1133556066 16:6907662-6907684 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1133565804 16:6992255-6992277 CCGGATTCAAGGGATTTTCCTGG + Intronic
1133796529 16:9050868-9050890 CCGGGTTCAAGCGATTTTCCTGG + Intergenic
1134153314 16:11822157-11822179 CCGGGTTCAAGCATTTCTCCTGG + Intergenic
1134177490 16:12019728-12019750 CCGGGTTCAAGCGATTCTCTTGG + Intronic
1134302444 16:13003762-13003784 CTGGCTTCAAGCGATTCTCCTGG - Intronic
1134649046 16:15893770-15893792 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1134761641 16:16719809-16719831 CCGGGTTCCAGCGATTCTCCTGG - Intergenic
1134984416 16:18639361-18639383 CCGGGTTCCAGCGATTCTCCTGG + Intergenic
1135006804 16:18831660-18831682 CCGGGTTCAAGAGATTCTCCTGG - Intronic
1135070550 16:19348016-19348038 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1135358398 16:21790167-21790189 CTGGGTTCAAGCAATTCTCCCGG + Intergenic
1135456901 16:22606292-22606314 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1135466894 16:22694361-22694383 CTGGGTTCAAACGATTCTCCTGG + Intergenic
1135963254 16:27015269-27015291 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1136139662 16:28280756-28280778 CCGGATTCAAGCGATTCTCCTGG + Intergenic
1136141293 16:28290539-28290561 CGGGGTTCAAGTGATTCTCCTGG - Intergenic
1136353046 16:29723909-29723931 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1136542254 16:30934562-30934584 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1136589574 16:31209637-31209659 CAGGGTTCAAGCAATTCTCCTGG + Intergenic
1136591508 16:31220560-31220582 CCGGGTTCAAGTGATTTTCGTGG + Intronic
1136988825 16:35139775-35139797 CGGGGTCCAATGGGTGTTCCTGG + Intergenic
1137234300 16:46601213-46601235 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1137420860 16:48332615-48332637 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1137739969 16:50759146-50759168 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1138346837 16:56325380-56325402 CTGGGTTCAAGAGATTCTCCTGG - Intronic
1138463488 16:57168707-57168729 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1138517693 16:57545917-57545939 CCGGGTTCAAACGATTCTCCTGG + Intronic
1138545008 16:57712759-57712781 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1138833272 16:60402411-60402433 CTGGGTTCAAGTGATCTTCCTGG + Intergenic
1138905301 16:61324247-61324269 AGGAGTTCAAGCCATTTTCCAGG + Intergenic
1139189207 16:64841958-64841980 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1139425564 16:66877825-66877847 CCGGGTTCAAGCGATTCTCCCGG - Intergenic
1139438791 16:66953371-66953393 CAGGGTTCAAGCAATTCTCCTGG - Intergenic
1139798151 16:69499560-69499582 TCGGGTTCAAGCGATTCTCCTGG - Intergenic
1139803751 16:69546136-69546158 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1139905578 16:70363428-70363450 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1139915186 16:70423768-70423790 CTGGGTTAAAGCGATTCTCCTGG + Intronic
1140105056 16:71952304-71952326 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1140404172 16:74696862-74696884 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1140441159 16:74988868-74988890 CCGGGTTCAAGCGATTCTCCCGG - Intronic
1140446607 16:75034062-75034084 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1140462375 16:75149893-75149915 CCGGGTTCAAGCAGTCCTCCTGG + Intronic
1140779629 16:78282782-78282804 CGAGGTTCAAGCGATTCTCCTGG - Intronic
1140835038 16:78785998-78786020 CTGGGTTCAAGCGATTCTCATGG + Intronic
1141099852 16:81189235-81189257 CGGGGTACACGGGGTGTTCCTGG + Intergenic
1141906507 16:87030176-87030198 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1142370656 16:89679024-89679046 CCAGGTTCAAGCAGTTCTCCTGG + Intergenic
1142636131 17:1259049-1259071 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1142656111 17:1395433-1395455 CCAGGTTCAAGCGGTTCTCCTGG - Intronic
1142832841 17:2562125-2562147 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1142857402 17:2738975-2738997 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1142875693 17:2850964-2850986 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1142951549 17:3485417-3485439 CGGGGTTCAAGCGATTCTCCTGG - Intronic
1142986013 17:3695758-3695780 AGGCGTGCACGCGGTTTTCCCGG - Intronic
1143133328 17:4694913-4694935 CCGGGTTCAAGCGATTCTCCCGG - Intronic
1143133332 17:4694932-4694954 CTGGGTTCAAGCGATTCTCCCGG - Intronic
1143192356 17:5049154-5049176 CTGGGTTCAAGCCATTCTCCTGG - Intronic
1143278456 17:5731993-5732015 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1143302210 17:5918892-5918914 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1143463628 17:7120744-7120766 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1143488737 17:7271083-7271105 CTGGGTTCAAGCAGTTCTCATGG - Intergenic
1143523274 17:7458064-7458086 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1143638591 17:8181795-8181817 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1143811636 17:9476544-9476566 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1144011772 17:11155678-11155700 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1144360319 17:14485901-14485923 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1144524436 17:15978502-15978524 CTGGGTTCAAGCGATTCTCATGG - Intronic
1144531549 17:16044073-16044095 CCGGGTTCAAGTGTTTCTCCTGG - Intronic
1144577882 17:16440759-16440781 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1145841261 17:27996691-27996713 CTGCGTTCAAGCTGTTTTTCAGG - Intergenic
1146079748 17:29768384-29768406 CTGGGCTCAAGCAGTTCTCCTGG + Intronic
1146134454 17:30306374-30306396 CTGGGTTCAAGCGATTCCCCTGG + Intergenic
1146243934 17:31261147-31261169 CTGGGTTCAAGCGATTTTCCTGG - Intronic
1146387782 17:32392599-32392621 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1146897421 17:36554459-36554481 CCGGGTTCAAGTGGTTCTCCTGG + Intronic
1146967894 17:37048462-37048484 CCAGGTTCAAGTGATTTTCCCGG + Intronic
1147017966 17:37507544-37507566 CCGGGTTCAAGCGATTCTCTTGG + Intronic
1147284797 17:39393193-39393215 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1147290932 17:39442501-39442523 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1147407395 17:40222145-40222167 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1147407528 17:40223235-40223257 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1147779473 17:42930036-42930058 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1147898012 17:43764353-43764375 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1147905343 17:43818840-43818862 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1148283244 17:46365466-46365488 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1148305462 17:46583387-46583409 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1148642269 17:49197059-49197081 CTGGGTTCAAGCATTTCTCCTGG + Intergenic
1148905799 17:50911274-50911296 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1149721848 17:58852695-58852717 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1150100184 17:62416590-62416612 CTGGGTTCAAGCCATTTTCCTGG + Intergenic
1150119002 17:62583669-62583691 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1150173014 17:63020018-63020040 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1150440343 17:65186288-65186310 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1150672973 17:67218026-67218048 CTGGGTTCAAGCGATCCTCCTGG + Intronic
1150970315 17:70019933-70019955 CTGGGTTCAAGCAATTCTCCAGG + Intergenic
1151004112 17:70413706-70413728 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1151427384 17:74039934-74039956 CTGGGTTCAAGCCATTTTCCTGG - Intergenic
1151583107 17:74991306-74991328 CTGGGTTCAAGAGATTCTCCTGG - Intronic
1151607159 17:75145068-75145090 CCGGGTTCAAGCACTTCTCCTGG - Intronic
1151780929 17:76244845-76244867 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1151832633 17:76563876-76563898 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1152122589 17:78427870-78427892 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1152182334 17:78831130-78831152 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1152255818 17:79238914-79238936 CAGGGTCCAATCTGTTTTCCTGG + Intronic
1152607149 17:81297544-81297566 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1152673813 17:81626220-81626242 CGGGGTTCAAGCGGTTTTCCTGG - Intronic
1152816247 17:82409799-82409821 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1152835156 17:82525067-82525089 CCGGGTTCAAGTGATTATCCTGG + Intronic
1152853709 17:82651733-82651755 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1153151020 18:2093465-2093487 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1153503719 18:5773748-5773770 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1153630805 18:7067945-7067967 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1153761439 18:8335926-8335948 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1153761564 18:8336881-8336903 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1154243952 18:12678860-12678882 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1154245788 18:12696407-12696429 CTGGGTTCAAGCGATTATACTGG - Intronic
1154952398 18:21223071-21223093 CGGGGTTCAAGCGATTCTCCTGG + Intergenic
1155023052 18:21914148-21914170 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1155046704 18:22109381-22109403 TTGGGTTCAAGCTATTTTCCTGG + Intergenic
1155131515 18:22939430-22939452 CTGGGTTCAAACGATTCTCCTGG - Intronic
1155154425 18:23146395-23146417 CCGGGTTCAAGCGATTGGCCAGG + Intronic
1155218048 18:23660711-23660733 TCGGGTTCAAGCGATTCTCCTGG - Intronic
1155290717 18:24338805-24338827 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1155466702 18:26143813-26143835 CTGGGTTCCAGCGATTCTCCTGG + Intronic
1155929475 18:31690561-31690583 CTGGGTTCAAGCGCTTCTGCTGG + Intergenic
1156878097 18:42041086-42041108 GCGGGTTCAAGCGATTCTCCTGG - Intronic
1157101941 18:44738678-44738700 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1157255112 18:46131817-46131839 CCGGGTTCAAGCGATTCTCCAGG - Intergenic
1157816462 18:50732871-50732893 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1158034282 18:53005632-53005654 TGGGGTTCAATCGATTCTCCTGG - Intronic
1158052086 18:53234333-53234355 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1158263718 18:55637018-55637040 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1158482091 18:57831010-57831032 CTGGGTTCAAGCGATTCTCGTGG - Intergenic
1158578262 18:58658580-58658602 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1158592957 18:58792726-58792748 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1158600348 18:58851088-58851110 CTGGGTTCAAGCGATTCTTCTGG - Intergenic
1158723261 18:59944964-59944986 TGGGGTTCAAGCTATTCTCCTGG + Intergenic
1158787248 18:60729661-60729683 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1158930173 18:62316356-62316378 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1159012665 18:63072736-63072758 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1159043602 18:63347400-63347422 CCTGGTTCAAGCGATTCTCCTGG - Intronic
1159101587 18:63964444-63964466 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1159212031 18:65336301-65336323 TCGGGTTCAAGCGATTCTCCTGG + Intergenic
1159334797 18:67048378-67048400 CTGGGTTCAAGAGATTCTCCTGG + Intergenic
1160165857 18:76511762-76511784 CTGGGTTCAAGTGATTCTCCCGG - Intergenic
1160182662 18:76648862-76648884 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1160409011 18:78662127-78662149 CCGGGTTCAAGTGATTGTCCTGG - Intergenic
1160617807 18:80147225-80147247 TGGGGCTCAAGCGCTTCTCCGGG + Intronic
1160956272 19:1693474-1693496 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1160977327 19:1799668-1799690 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1160997590 19:1890707-1890729 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1161023194 19:2021395-2021417 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1161036267 19:2086452-2086474 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1161175351 19:2839238-2839260 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1161192895 19:2969073-2969095 CCGGGTTCAAGCGATTCTCAAGG + Intergenic
1161499469 19:4605840-4605862 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1161545995 19:4880263-4880285 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1161656013 19:5515414-5515436 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1161663600 19:5561693-5561715 CTGGGTTCAAGCGATTCTCTTGG + Intergenic
1161664913 19:5569479-5569501 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1161708664 19:5834704-5834726 CCGGGTTCAAGCGATTCTCATGG - Intronic
1161791167 19:6361220-6361242 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1161816815 19:6504250-6504272 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1161865621 19:6830150-6830172 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1161904529 19:7146333-7146355 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1161925711 19:7297552-7297574 CTGGGTTCAAGCGATCTTCCTGG + Intergenic
1162077528 19:8198015-8198037 CTGGGTTCAAGGGATTCTCCTGG - Intronic
1162294317 19:9802629-9802651 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1162321835 19:9975166-9975188 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1162339090 19:10080898-10080920 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1162355654 19:10183207-10183229 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1162405377 19:10469923-10469945 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1162459676 19:10807164-10807186 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1162529039 19:11224968-11224990 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1162538411 19:11277901-11277923 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1162559928 19:11411113-11411135 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1162624647 19:11874916-11874938 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1162705831 19:12554200-12554222 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1162874967 19:13614333-13614355 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1162907491 19:13832427-13832449 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1162942574 19:14022002-14022024 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1163106651 19:15126986-15127008 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1163301346 19:16448734-16448756 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1163409475 19:17144874-17144896 CCGAGTTCAAGCGGTTCTCCTGG - Intronic
1163452472 19:17386503-17386525 CAGGGTTCAAGCGATTCTCCTGG + Intergenic
1163555832 19:17992505-17992527 CCCGGTTCAAGCGATTCTCCTGG - Intronic
1163617393 19:18337643-18337665 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1163656673 19:18550061-18550083 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1163707558 19:18824251-18824273 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1163827474 19:19531823-19531845 CCGGGTTCAAGCGATTCTCCAGG + Intronic
1163856094 19:19703472-19703494 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1163918419 19:20264172-20264194 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1163950522 19:20580450-20580472 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1164727065 19:30473110-30473132 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1164745082 19:30606058-30606080 CTAGGCTCAAGCAGTTTTCCAGG - Intronic
1165054764 19:33167877-33167899 CTGGGTTCAAGCAATTCTCCCGG + Intronic
1165243625 19:34485174-34485196 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1165247566 19:34505909-34505931 CTGGGTTGATGCGGATTTCCAGG + Exonic
1165757561 19:38303179-38303201 CCGGGTTCAAGTGATTATCCTGG + Intronic
1165781889 19:38439598-38439620 CTGGGTTCAGGCGATTCTCCTGG + Intronic
1166298348 19:41900238-41900260 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1166320612 19:42016325-42016347 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1166337879 19:42119668-42119690 CTGGGTTCAAGCGATTTTTGAGG - Intronic
1166767415 19:45259991-45260013 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1166827431 19:45618155-45618177 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1166979239 19:46623073-46623095 CGGGGTTCAAGCGATTCTCCTGG + Intronic
1167033997 19:46982381-46982403 CTGGGTTCAAGCGATTCTCATGG - Intronic
1167076868 19:47255652-47255674 CGGGGTTCACGCCATTCTCCTGG + Intergenic
1167155993 19:47739505-47739527 ATGGGTTCAAGCGATTCTCCTGG - Intronic
1167190622 19:47986508-47986530 CTGGGTTCAAGCAGTCCTCCTGG - Intronic
1167192879 19:48004035-48004057 CTGGGTTCAAGCGATTTTCCTGG + Intronic
1167218027 19:48177989-48178011 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1167332234 19:48863345-48863367 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1167412296 19:49351890-49351912 CCGGGTTCAAGCAGTTCTCCTGG - Intronic
1167753223 19:51393674-51393696 CTGGGTTCGAGCGATTCTCCTGG + Intergenic
1167926676 19:52826780-52826802 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1167994710 19:53392996-53393018 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1168003218 19:53465617-53465639 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1168016815 19:53580735-53580757 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1168085278 19:54041393-54041415 CCGGGTTCAAGCCATTCTCCTGG + Intronic
1168099890 19:54135574-54135596 CCGGGTTCAAGTGATTCTCCCGG + Intergenic
1168610290 19:57793931-57793953 GTGGGTTCAAGCAATTTTCCTGG + Intronic
926041046 2:9673464-9673486 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
926344357 2:11931598-11931620 CTGGATTCAAGCGATTCTCCTGG + Intergenic
926741845 2:16117868-16117890 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
926899312 2:17732603-17732625 CTGGGTTCAAGCGATTCTCCTGG - Intronic
927131476 2:20064116-20064138 CCGGATTCAAGCGATTCTCCTGG + Intergenic
927529504 2:23781569-23781591 CTGGGTTCAAGTGATTCTCCTGG - Intronic
927640430 2:24842151-24842173 TGGGCTTCAAGAGGTTTTCCAGG - Intronic
927761451 2:25759046-25759068 CCAGGTTCAAGCGATTCTCCTGG + Intronic
928945886 2:36771430-36771452 CCGGGTTCAAGCGATTCTCCTGG - Intronic
928989723 2:37220221-37220243 CCGGGTTCAAGCCATTCTCCTGG - Intronic
929320038 2:40532068-40532090 CTGGGTTCAAGCGATTCTCCTGG + Intronic
929464731 2:42134178-42134200 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
929707951 2:44235507-44235529 CTGGGTTCAAGCAATTATCCTGG - Intronic
929709523 2:44252201-44252223 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
929884882 2:45869799-45869821 CTGGGTTCAAGCAATTCTCCTGG + Intronic
930090258 2:47526637-47526659 CCGGATTCAAGCGATTCTCCTGG - Intronic
930193971 2:48489949-48489971 CTGGGTTCAAGCCATTCTCCTGG - Intronic
930199979 2:48543623-48543645 CTGGGTTCAAGCAATTTTCCTGG + Intronic
930330554 2:49978066-49978088 CCTGGTTCAAGCGATTCTCCTGG - Intronic
930633312 2:53778053-53778075 CTGGGTTCAAGCAATTCTCCTGG - Intronic
930663810 2:54082337-54082359 GCAGGTTCAAGCGGTTCTCCTGG + Intronic
930748352 2:54907412-54907434 CCCGGTTCAAGCGATTCTCCTGG - Intronic
930767940 2:55104142-55104164 CTGGGTTCAAGCGATTCTCCTGG + Intronic
930778477 2:55198489-55198511 CTGGGTTCAAGCGATTCTCCTGG - Intronic
930866703 2:56129161-56129183 TTGGGTTCAAGCGATTATCCTGG + Intergenic
931307181 2:61041098-61041120 CTGGGCTCAAGCGATTTGCCAGG - Intronic
931329255 2:61263100-61263122 CCAGGTTCAAGCGATTCTCCTGG + Intronic
931348459 2:61468276-61468298 CCGGGTTCAAGCAATTCTCCTGG + Intronic
931351139 2:61489982-61490004 CTGGGTTCAAGCCATTCTCCTGG + Intronic
931675784 2:64695022-64695044 CCGGGTTCAAGCAATTCTCCTGG + Intronic
931720285 2:65062437-65062459 CCGGGTTCAAGCAATTCTCCTGG - Intronic
931769435 2:65485131-65485153 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
931827781 2:66019240-66019262 CTGGGTTCAAGTGATTCTCCGGG - Intergenic
931871672 2:66467501-66467523 CTGGGTTCAAGCGATTCTCCTGG - Intronic
932182183 2:69657086-69657108 CTGGGTTCAAGCAATTCTCCTGG + Intronic
932261137 2:70328646-70328668 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
932358227 2:71084296-71084318 CGTGGTTCAAGCGATTCTCCTGG - Intergenic
932561967 2:72881175-72881197 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
932781777 2:74563150-74563172 CTGGGTTCAAGCAGTCTTCCTGG - Intronic
932822044 2:74909784-74909806 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
933126080 2:78607928-78607950 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
933274027 2:80265066-80265088 CTGGGTTCAAGCAATTCTCCTGG + Intronic
933450076 2:82437948-82437970 CTGGCTTCAAGCGATTCTCCTGG - Intergenic
933716511 2:85365254-85365276 CCGGGTTCAAGTGATTCTCCTGG - Intronic
933998855 2:87689731-87689753 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
934652877 2:96102393-96102415 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
934978074 2:98819911-98819933 CTGGGTTCAAGCGATTCTCCTGG + Intronic
935031217 2:99324665-99324687 CTGGGTTCAAGCAATTCTCCTGG + Intronic
935271550 2:101438903-101438925 CTGGGTTCAAGCGATTCTCCTGG + Intronic
935541315 2:104352598-104352620 CTGGGTTCAAGTGATTTTCCTGG + Intergenic
936026989 2:109039442-109039464 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
936294991 2:111261152-111261174 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
937215467 2:120310070-120310092 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
937360843 2:121229011-121229033 CAGGGTTCAAGCAATTCTCCTGG + Intronic
937401239 2:121585801-121585823 CTGGGTTCAAGCGATTCTCCTGG - Intronic
937669028 2:124518893-124518915 CTGGGTTCAAGCGATTCTCCTGG - Intronic
938880574 2:135582235-135582257 CCGGGTTCAAGTGATTCTCCTGG - Intronic
938897649 2:135768290-135768312 CCAGGTTCAAGCGATTCTCCTGG + Intronic
939365689 2:141228018-141228040 CTGGGTTCAAGCGATTCTTCTGG + Intronic
940000468 2:148962257-148962279 CAGGGTTCAAGCCATTCTCCTGG + Intronic
940388329 2:153100933-153100955 TCGGGTTCCAGCGATTTTCCTGG - Intergenic
940787714 2:158000155-158000177 CTGGGTTCAAGTGATTCTCCTGG + Intronic
941591520 2:167426366-167426388 CTGGGTTCAGGCAGTTCTCCTGG + Intergenic
941879744 2:170469040-170469062 CTGGGTTCAAGCGATTCTCCTGG - Intronic
942036317 2:172013912-172013934 CTGGGTTCAAGCGATTCTCCTGG + Intronic
942107285 2:172645362-172645384 CCGGGTTCAAGCGGTTCTCCTGG + Intergenic
942119303 2:172761217-172761239 CTGGGTTCAAGCGATTCTCCTGG + Intronic
942704563 2:178755527-178755549 CTGGGTTCAAGCGATTCTCCTGG + Intronic
942987182 2:182157106-182157128 CTGGGTTCAATCGATTCTCCTGG + Intronic
943259973 2:185647111-185647133 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
943733834 2:191332054-191332076 CTGGGTTCAAGTGATTCTCCTGG + Intronic
944190440 2:196997541-196997563 CCGGGTTCAAACGATTCTCCTGG + Intronic
944239467 2:197471846-197471868 CTGGGTTCAAGTGATTCTCCTGG - Intronic
944490831 2:200256043-200256065 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
944575763 2:201089711-201089733 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
944722080 2:202433812-202433834 CCGGGTTCAAGCAATTCTCCTGG - Intronic
944734164 2:202546695-202546717 CTGGGTTCAAGCGATTTTTCTGG + Intronic
944762076 2:202826563-202826585 CTGGGTTCAAGCGATTCTTCTGG + Intronic
944795451 2:203179865-203179887 CCGGGCTCAAGCAGTTCTCCTGG + Intronic
944818798 2:203408254-203408276 CTGGGTTCAAGCGATTCTCCTGG + Intronic
945239144 2:207660505-207660527 TGGGGTTCAAGCGATTCTCCTGG - Intergenic
945239700 2:207665157-207665179 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
945332029 2:208551105-208551127 CCGGGTTCAAGTGATTCTCCTGG + Intronic
945625401 2:212198666-212198688 CCGGGTTCAAGCGATTCTCCTGG + Intronic
945651349 2:212564161-212564183 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
946236566 2:218327866-218327888 CTGGGTTCAAGCGATTCTCCTGG - Intronic
946250929 2:218411820-218411842 CCGGGTTCAAGCAATTTTCCTGG + Intergenic
946297015 2:218793167-218793189 CTGGGTTCAAGTGATTCTCCTGG + Intronic
946398776 2:219457488-219457510 CGAAGTTCAAGCGATTCTCCTGG - Intronic
946752930 2:222911141-222911163 CTGGGTTCAAGTGATTGTCCTGG + Intronic
946795058 2:223341600-223341622 CCGGGTTCAAGCAATTCTCCAGG - Intergenic
947660108 2:231860195-231860217 CTGGGTTCAAGCGATTCTCTTGG + Intergenic
947697127 2:232200875-232200897 CTGGGTTCAAGCAATTCTCCTGG + Intronic
947780289 2:232754069-232754091 CCAGGTTCAAGCGATTCTCCTGG - Intronic
947885871 2:233570524-233570546 CCAGGTTCAAGCAGTTCTCCTGG + Intergenic
948242643 2:236450411-236450433 CGGGGTTCAAGTGATTCTCGTGG + Intronic
948984161 2:241509671-241509693 AGGGGTTCAAGGGGCTGTCCTGG - Intronic
949051127 2:241897961-241897983 CTGGGCTCAAGCAGTCTTCCTGG + Intronic
1168789499 20:566787-566809 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1169320368 20:4627480-4627502 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1169371548 20:5031995-5032017 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1170059608 20:12245356-12245378 CTGGGTTCAAGTGATTTTCCAGG - Intergenic
1170261952 20:14419146-14419168 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1170262332 20:14423854-14423876 CTGGGTTCAAGAGATTCTCCTGG + Intronic
1170739234 20:19039639-19039661 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1170922028 20:20688210-20688232 CTGGGTTCAAGTGATTCTCCAGG - Intronic
1170986283 20:21262438-21262460 CTGAGTTCAAGCGATTCTCCTGG + Intergenic
1171211174 20:23318132-23318154 CTGGGTTCAAGCAATTCTCCAGG + Intergenic
1172260412 20:33559578-33559600 CTGGGTTCAAGCCATTCTCCTGG + Intronic
1172282145 20:33715517-33715539 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1172410624 20:34719535-34719557 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1172551358 20:35802843-35802865 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1173736057 20:45362458-45362480 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1173797214 20:45869948-45869970 CTGGGTTCCAGCGATTCTCCTGG - Intronic
1173814051 20:45973628-45973650 CCGGGTTCAAGCTATTGTCCTGG - Intergenic
1174064814 20:47856824-47856846 CCAGGTTCAAGCGGTTCTCCAGG + Intergenic
1174477960 20:50810682-50810704 CTGGGTTCACGCCGTTTTCCTGG + Intronic
1174490121 20:50887029-50887051 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1174662388 20:52224946-52224968 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1174738345 20:52986633-52986655 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1174740172 20:53005217-53005239 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1174786430 20:53437377-53437399 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1174879753 20:54266137-54266159 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1175051751 20:56161891-56161913 CCGGGTTCAAGCGTTTCTCCTGG - Intergenic
1175103486 20:56596844-56596866 CCGGGTACAAGCGATTCTCCTGG - Intergenic
1175239945 20:57539671-57539693 CCTGGTTCAAGCGATTCTCCTGG + Intergenic
1175617935 20:60419084-60419106 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1175660726 20:60809838-60809860 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1176158124 20:63633349-63633371 CTGGGTTCAAGTGATTTTCCTGG + Intergenic
1176371361 21:6063644-6063666 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1176426046 21:6548882-6548904 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1176764328 21:13000732-13000754 CCAGGTTCAAGCGATTTTCCTGG - Intergenic
1176970825 21:15263584-15263606 CAGGGATCAAGCCCTTTTCCAGG + Intergenic
1177368702 21:20173648-20173670 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1177542395 21:22511508-22511530 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1177590855 21:23164926-23164948 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1177649794 21:23945989-23946011 CGGGGTTCACACTGTTCTCCTGG + Intergenic
1177840007 21:26225169-26225191 AGGGGTTTGAGAGGTTTTCCTGG - Intergenic
1178000689 21:28159071-28159093 CTGGATTCAAGCGATTCTCCTGG + Intergenic
1178524569 21:33316194-33316216 TGGAGTTCAAGCGATTCTCCAGG + Intergenic
1178867718 21:36343540-36343562 CTGGGTTCAAGCGATTCTTCTGG + Intronic
1178949145 21:36971733-36971755 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1179213055 21:39342129-39342151 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1179625645 21:42647948-42647970 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1179701537 21:43157199-43157221 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1179752158 21:43474895-43474917 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1179819243 21:43926883-43926905 CTGGGTTCAAGCAATTCTCCGGG - Intronic
1179876113 21:44268777-44268799 CTGGGTTCAAGCAGTTCTCCTGG + Intergenic
1180439477 22:15350656-15350678 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1180660814 22:17465576-17465598 CTGGGTTCAAACGATTCTCCTGG + Intronic
1180890531 22:19284859-19284881 CCCGGTTCAAGCGATTCTCCTGG - Intronic
1181017443 22:20079464-20079486 CCGGATTCAAGCGATTCTCCTGG - Intergenic
1181261355 22:21600217-21600239 CCCGGTTCAAGCGATTCTCCTGG - Intronic
1181274330 22:21678988-21679010 TTGGGTTCAAGCGATTCTCCTGG + Intronic
1181276584 22:21691056-21691078 CTGGGTTCAAGCGGTTCTCCTGG + Intronic
1182227719 22:28812476-28812498 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1182954203 22:34406168-34406190 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1183208819 22:36437452-36437474 CCGAGTTCAAGCGATTCTCCTGG + Intergenic
1183527261 22:38330719-38330741 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1183539582 22:38422283-38422305 CTGGGTTCAAGAGATTCTCCTGG - Intergenic
1183982885 22:41552764-41552786 CAGGGTTCAAGTGATTCTCCTGG + Intergenic
1184437308 22:44487104-44487126 CCGGATTCAAGTGGTTCTCCTGG - Intergenic
1184535019 22:45080907-45080929 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1184676968 22:46048781-46048803 CTGGGTTCAAGCGATTCACCTGG + Intergenic
1185361516 22:50410568-50410590 CTGGGTTCAAGCGATTCTCATGG + Intronic
949143935 3:672348-672370 CCAGGTTCAAGCAATTTTCCAGG + Intergenic
949306848 3:2651620-2651642 CTGGGCTCAAGCGATCTTCCTGG - Intronic
949682478 3:6530557-6530579 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
949991958 3:9586807-9586829 CTGGGTTCAAGCGATTATACTGG + Intergenic
950056631 3:10030188-10030210 CCGGGTTCAAGCGATTCTCCTGG + Intronic
950235413 3:11315818-11315840 CCTGGTTCAAGCGATTCTCCTGG + Intronic
950492161 3:13312403-13312425 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
950660851 3:14466166-14466188 CTGGGTTCAAGTGATTCTCCTGG - Intronic
951303981 3:21035197-21035219 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
951486773 3:23221728-23221750 CTGGATTCAAGCGATTCTCCTGG + Intronic
951879399 3:27465193-27465215 CTGGGTTCAAGCGATTCTCGTGG - Intronic
951930639 3:27963302-27963324 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
952153958 3:30622784-30622806 CTGGGTTCAAGTGATTCTCCTGG - Intronic
952335969 3:32403306-32403328 CTGGGCTCAAGCGATCTTCCTGG + Intronic
953296786 3:41726707-41726729 CTGGGTTCAAGTGATTCTCCTGG + Intronic
953968315 3:47327143-47327165 CTGGGTTCAAGTGATTCTCCTGG - Intronic
954051209 3:47979547-47979569 CTGGGTTCAAGAGATTCTCCAGG + Intronic
954302612 3:49708078-49708100 CCGGGTTCAAGCAGTTCTCCTGG + Intronic
954470299 3:50688554-50688576 CTGGGTTCAAGCGATTCTCCTGG + Intronic
955367330 3:58322149-58322171 CCGGGTTCAAGCGATTCTCTTGG + Intergenic
955539255 3:59956572-59956594 CCGGGTTCAAGCAATTCTCCTGG - Intronic
956106317 3:65822432-65822454 CTGGGTTCAAGTGATTTTTCTGG - Intronic
956112656 3:65885301-65885323 CTGGGTTCAAGTGATTCTCCTGG - Intronic
956318737 3:67970784-67970806 CTGGGTTCAAGGGATTCTCCTGG + Intergenic
956687951 3:71848910-71848932 CTGGGCTCAAGCGATCTTCCTGG + Intergenic
956818436 3:72930070-72930092 CTGGGTTCAAGTGATTCTCCTGG - Intronic
957962847 3:87280843-87280865 CCGAGTTCAAGCGATTCTCCAGG - Intergenic
958887968 3:99750148-99750170 CTGGGTTCAAGCAATTCTCCTGG + Intronic
958979243 3:100701795-100701817 CTGGGTTCAAGCGATTCTTCTGG + Intergenic
959150298 3:102599791-102599813 CCGGGTTCATGCCATTTTCCTGG + Intergenic
959404898 3:105949331-105949353 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
959473804 3:106785295-106785317 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
959648394 3:108727764-108727786 CTGAGTTCAAGCGATTCTCCTGG - Intergenic
959691862 3:109206303-109206325 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
959703773 3:109321681-109321703 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
959712333 3:109397480-109397502 CTGGGCTCAAGCGATTCTCCTGG - Intergenic
960134512 3:114091775-114091797 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
960361204 3:116713870-116713892 CCGGGTTCAAGTGATTCTCCTGG - Intronic
960630920 3:119729548-119729570 CCGGGTTCAAGCAGTTTTCATGG - Intronic
960637109 3:119794843-119794865 CTGGGTTCAAGCAATTCTCCTGG - Intronic
960641966 3:119833787-119833809 CTGGGTTCAAGGGATTCTCCTGG + Intronic
960652716 3:119969196-119969218 CTGGGTTCAAGCAATTCTCCTGG - Intronic
960936191 3:122904369-122904391 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
961000142 3:123368501-123368523 CTGGGTTCAAGCAATTCTCCTGG - Intronic
961263877 3:125624700-125624722 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
961596093 3:128018342-128018364 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
961596680 3:128023176-128023198 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
962231745 3:133671697-133671719 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
962303484 3:134265109-134265131 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
962337279 3:134546450-134546472 CGAGGTTCAAGCCATTCTCCAGG + Intronic
962542845 3:136400627-136400649 CCGGGTTCAAGTGATTCTCCTGG + Intronic
962725711 3:138224655-138224677 CTGGGTTCAAGTGATTTTCATGG - Intronic
962792542 3:138824597-138824619 CCGGGTTCAAGTGATTCTCCTGG - Intronic
962796348 3:138852811-138852833 CTGGGTTCAAGCGATTCTTCTGG + Intergenic
962800070 3:138882859-138882881 CCGGGTTCAAGCGATTCTCCCGG + Intergenic
962855769 3:139343575-139343597 CTCGGTTCAAGCGATTCTCCTGG + Intronic
963034967 3:141018087-141018109 CAGGGTTCAAGCGATTCTCCTGG - Intergenic
963694200 3:148544397-148544419 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
963796074 3:149632138-149632160 CTGGGTTCAAGCGATCTGCCTGG + Intronic
964045936 3:152326894-152326916 CTGGGTTCAAGTGATTCTCCTGG + Intronic
964277709 3:155025528-155025550 CTGGGTTCAAGTGATTCTCCTGG - Intronic
964686963 3:159405787-159405809 CTGGGTTCAAGTGATTCTCCTGG - Intronic
964797534 3:160516078-160516100 CCAGGTTCAAGCGATTCTCCTGG + Intronic
965109170 3:164400370-164400392 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
965124689 3:164611341-164611363 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
965283726 3:166788634-166788656 CTGGGCTCAAGCGATCTTCCAGG + Intergenic
965566467 3:170123938-170123960 CTGGGTTCAAGCGATTCTCCTGG + Intronic
965591339 3:170362719-170362741 CCAGGTTCAAGCGATTCTCCTGG - Intronic
965600844 3:170453578-170453600 CCTGGTTCAAGCGATTCTCCTGG + Intronic
965635356 3:170775113-170775135 CCGGGTTCAAGCAATTCTCCGGG + Intronic
965746265 3:171929227-171929249 CTGGGTTCAAGCGATTCTCCCGG + Intronic
965938653 3:174147525-174147547 CTGGGTTCAAGTGATTATCCTGG + Intronic
965964229 3:174467497-174467519 CCGGGTTCAAGCAATTCTCCTGG - Intronic
965981525 3:174697995-174698017 CTGGGTTCAAGCGATTCTCCTGG - Intronic
966003583 3:174980404-174980426 CTGGGTTCAAGTGATCTTCCTGG - Intronic
966023085 3:175240747-175240769 CCAGGTTCAAGCGATTCTCCTGG + Intronic
966172723 3:177100515-177100537 CTGAGTTCAAGTGGTTCTCCTGG + Intronic
966185721 3:177224994-177225016 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
966410412 3:179641309-179641331 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
966798147 3:183735778-183735800 CCGGGTTCAAGCGATTGTCGTGG + Intronic
967031859 3:185615435-185615457 CTGGGTTCAAGTGATTCTCCTGG + Intronic
967905822 3:194498950-194498972 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
968029797 3:195474000-195474022 CCGGGTTCAAGCGGTTCTCGTGG + Intergenic
968117669 3:196101885-196101907 CTGGGTTCAAGTGATTGTCCTGG - Intergenic
968175575 3:196546800-196546822 TCGGGTTCAAGCGGTTTTTTTGG + Intergenic
968313645 3:197704338-197704360 CTGGGTTCAAGCAATTCTCCCGG - Intronic
968331291 3:197872759-197872781 CTGGGTTCAAGTGATTCTCCTGG - Intronic
968352148 3:198066773-198066795 CGAGGTTCAAGCGATTCTCCTGG - Intergenic
968837988 4:2979617-2979639 CTGGGTTCAAGCAATTCTCCTGG - Intronic
969204750 4:5635128-5635150 CTGGGTTCAAGTGATTCTCCTGG + Intronic
969273593 4:6119448-6119470 CCGGGTTCAAGCGATTCTCCTGG - Intronic
969412576 4:7038993-7039015 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
971067544 4:23050813-23050835 GTGGGTTCAAGCGATTCTCCTGG + Intergenic
971314992 4:25560249-25560271 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
971456914 4:26853629-26853651 CCAGGTTCAAGCCGTTCTCCTGG + Intergenic
972157781 4:36185882-36185904 ATGGGTTCAAGCGATTGTCCTGG - Intronic
972473611 4:39430692-39430714 CTGGGTTCAAGTGATTCTCCTGG + Intronic
972517819 4:39825679-39825701 CTGGGTTCAAGTGGTCCTCCAGG + Intronic
972595946 4:40530027-40530049 CCGGGTTCAAGCGATTCTCCTGG + Intronic
972637080 4:40893878-40893900 CTGGGTTCAAGCGATTGTCCTGG - Intronic
972684371 4:41337585-41337607 CTGGGTTCAAGCCGTCCTCCTGG + Intergenic
972779530 4:42274403-42274425 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
972992363 4:44836382-44836404 CCAGGTTCAATCGATTTTCCTGG + Intergenic
973152653 4:46907945-46907967 CCGGGTTCAAGCGATTCTCCCGG + Intronic
973575695 4:52286632-52286654 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
973921157 4:55686530-55686552 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
974333927 4:60515155-60515177 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
974930004 4:68350613-68350635 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
975135947 4:70874648-70874670 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
975136651 4:70881412-70881434 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
975563514 4:75729431-75729453 CTGGGTTCAAGCAGTTCTCCTGG + Intronic
975780774 4:77837491-77837513 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
976204370 4:82610477-82610499 CAGGGTTCAAGTGATTCTCCTGG + Intergenic
976250043 4:83041154-83041176 CCGGGTTCAAGCGATTCTTCTGG + Intronic
976618781 4:87106287-87106309 CTGGGTTCAAGCGATTCTCCTGG - Intronic
976640794 4:87335843-87335865 CGGGGTTCAAATGATTCTCCTGG + Intergenic
976872402 4:89811348-89811370 CTGGGTTCGAGCGATTCTCCTGG + Intronic
977113456 4:92990384-92990406 CTGGGTTCAAGTGATTCTCCTGG + Intronic
978251267 4:106634085-106634107 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
978569478 4:110120892-110120914 CCGGGTTCAAGCGATTCTCCTGG + Intronic
978574120 4:110171313-110171335 CCAGGTTCAAGCGATTCTCCTGG - Intronic
978792014 4:112672488-112672510 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
978915481 4:114122013-114122035 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
979231746 4:118354366-118354388 CCAGGTTCAAGCGATTTTCCTGG - Intergenic
979686645 4:123517730-123517752 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
979840100 4:125428202-125428224 CCGGGTTCAAGCGATTCTCCTGG - Intronic
980044750 4:127974900-127974922 CTGGGTTCAAGCAATTCTCCTGG - Intronic
980050875 4:128038814-128038836 CCGGGTTCAAGCGATTCTCCTGG - Intronic
980051376 4:128043568-128043590 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
980053222 4:128058275-128058297 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
980128503 4:128796455-128796477 CGGGGTTCAAGTGATTCTGCTGG + Intergenic
980293622 4:130879035-130879057 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
981120141 4:141040128-141040150 CGGGGTTCTTGCAGTCTTCCAGG - Intronic
981244031 4:142513499-142513521 CTGGGTTCAAGTGATTCTCCTGG + Intronic
981667589 4:147246977-147246999 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
982340507 4:154293294-154293316 CCAGGTTCAAGCGATTCTCCCGG + Intronic
982696931 4:158612702-158612724 CTGGGTTCAAGCCATTCTCCTGG + Intronic
982774785 4:159430629-159430651 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
982974800 4:162042054-162042076 CTGGGTTCAAGTGATTCTCCTGG - Intronic
983203428 4:164886917-164886939 CCAGGTTCAAGCAGTTCTCCTGG + Intronic
983568891 4:169183372-169183394 CCGGGTTCAAGTGATTCTCCTGG + Intronic
983966660 4:173820687-173820709 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
984114370 4:175661339-175661361 CTGGGTTCAAGTGATTCTCCTGG - Intronic
984230022 4:177084402-177084424 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
984826159 4:183926715-183926737 CCGGGTTCAAGCAGTTCTCCTGG + Intronic
984928050 4:184824217-184824239 CTGAGTTCAAGCGATTCTCCTGG + Intronic
984973167 4:185208632-185208654 CTGGGTTCAAGCCATTCTCCTGG - Intronic
985110709 4:186544112-186544134 CTGGGTTCAAGCAATTCTCCTGG + Intronic
985479346 5:98526-98548 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
985862010 5:2478504-2478526 CGGGGTTCAAGCAATTCTCCTGG + Intergenic
986109368 5:4696271-4696293 CTGGGTTCAAGTGATTCTCCAGG - Intergenic
987327685 5:16827378-16827400 CTGGGTTCAAGCAATTCTCCTGG + Intronic
987508673 5:18807230-18807252 CTGGGCTCAAGCGATTCTCCTGG + Intergenic
987846349 5:23292106-23292128 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
987877573 5:23698573-23698595 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
987920056 5:24268120-24268142 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
988076880 5:26364851-26364873 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
988595494 5:32586229-32586251 CGGGGTTCTAGCGGCTTGCTGGG + Intronic
988906454 5:35795742-35795764 AGGGGTTCAAGAGGATTTTCTGG - Exonic
988982217 5:36582912-36582934 CTGAGTTCAAGCGATTCTCCTGG - Intergenic
989394805 5:40942856-40942878 CTGGGTTCAAGCGATTCTCCTGG + Intronic
989641619 5:43588559-43588581 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
990480763 5:56208516-56208538 CTGGGTTCAAGCAATTCTCCTGG + Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
991369651 5:65904866-65904888 TTGGGTTCAAGCGATTCTCCTGG - Intergenic
991578162 5:68126501-68126523 CCGGGTTCAAGCAATTGTCCTGG - Intergenic
992053559 5:72964475-72964497 CCGGGTTCAAGTGATTCTCCTGG + Intronic
992116496 5:73543145-73543167 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
992240615 5:74765903-74765925 CCGGGTTCAAGCGATTCTCCAGG - Intronic
992253257 5:74896535-74896557 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
992254244 5:74905791-74905813 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
992536777 5:77714224-77714246 CCGGGTTCAAGCGATTCTCCTGG - Intronic
992557440 5:77917137-77917159 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
992617983 5:78563605-78563627 CTGGGTTCAAGCGATTCTCCTGG - Intronic
992806763 5:80345278-80345300 CCGGGTTCAAGCCATTGTCCTGG - Intergenic
993480755 5:88421888-88421910 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
993677718 5:90837462-90837484 CTGGGTTCAAGCTATTCTCCCGG + Intronic
993721537 5:91325946-91325968 CCGGGTTCAAGCGATTCTCGTGG - Intergenic
994071574 5:95608804-95608826 CCGGGTTCAAACGATTCTCCTGG - Intergenic
995575494 5:113527882-113527904 CCAGGTTCAAGCGATTCTCCTGG + Intronic
996153154 5:120064658-120064680 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
996436235 5:123435442-123435464 CTAGGTTCAAGCGATTCTCCTGG - Intergenic
996717301 5:126598273-126598295 CTGGGTTTAAGCGATTCTCCAGG - Intergenic
997300385 5:132799335-132799357 CCGGGTTCAAACGATTCTCCTGG - Intronic
997448197 5:133958481-133958503 CCAGGTTCAAGCGATTTTCATGG - Intronic
997880106 5:137581830-137581852 CCAGGTTCAAGCAATTTTCCTGG + Intronic
998010114 5:138688199-138688221 CTGGGCTCAAGTGGTTCTCCTGG - Intronic
998078383 5:139254989-139255011 CTGGGTTCAAGCCATTTTCCTGG + Intronic
998102795 5:139448246-139448268 GAGGGTTCAAGTGGTTCTCCTGG - Intergenic
998260383 5:140626492-140626514 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
998346764 5:141471141-141471163 CTGGGTTCAAGTGATTCTCCTGG + Intronic
998588131 5:143449647-143449669 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
999189478 5:149736046-149736068 CTGGGTTCAAGCAATTCTCCGGG - Intronic
999284944 5:150388835-150388857 CTGGGTTCAAGCGATTCTCGTGG - Intronic
999312877 5:150563416-150563438 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
999742309 5:154565628-154565650 CTGGGTTTAAGTGGTTCTCCTGG - Intergenic
999748770 5:154610872-154610894 CGGGGTTCAAGACGAGTTCCAGG + Intergenic
999992832 5:157064772-157064794 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1000838090 5:166180838-166180860 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1001020579 5:168179039-168179061 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1001045321 5:168366889-168366911 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1001091307 5:168743036-168743058 CAGGGTTCATGCCATTTTCCTGG - Intronic
1001389876 5:171370247-171370269 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1001517240 5:172364569-172364591 CCGGGTTCAAGCGATTCTCATGG - Intronic
1001930177 5:175667348-175667370 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1002123178 5:177021744-177021766 CCGGGTTCAAGCCATTCTCCTGG + Intronic
1002166822 5:177352721-177352743 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1002172227 5:177381770-177381792 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1002489786 5:179566958-179566980 CTGGGTTCAAGCGATTCTCATGG - Intronic
1002784325 6:390684-390706 CCGGGTTCAAGCGATTCTCGTGG + Intergenic
1003404826 6:5819855-5819877 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1003938410 6:10999467-10999489 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1004038767 6:11953053-11953075 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1004214184 6:13686196-13686218 CTGGGCTCAAGCGATCTTCCTGG + Intronic
1004323022 6:14647864-14647886 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1004441747 6:15661550-15661572 CCGGATTCAAGCGATTCTCCTGG - Intronic
1004853761 6:19727578-19727600 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1004865176 6:19846216-19846238 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1004942814 6:20579069-20579091 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1005019537 6:21404481-21404503 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1005383259 6:25259694-25259716 CTGGGTTCAAGCGATTCTCGTGG - Intergenic
1005748030 6:28857607-28857629 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1005839482 6:29732537-29732559 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1005970291 6:30755634-30755656 CCTGGTTCAAGCGATTCTCCTGG - Intergenic
1006025469 6:31143963-31143985 CCGGGTTCAAGCCATTCTCCTGG - Intronic
1006309223 6:33245595-33245617 CCGGGTTCAAGCGATTCCCCTGG - Intergenic
1006546326 6:34784936-34784958 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1006630164 6:35425178-35425200 TCGGGTTCAAGCGATTCTCCTGG - Intronic
1006882455 6:37352252-37352274 CTGGGTTCAAGCGAGTCTCCTGG + Intergenic
1007580809 6:42958839-42958861 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1007580984 6:42960102-42960124 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1009423565 6:63489798-63489820 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1009434675 6:63604073-63604095 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1009759981 6:67992924-67992946 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1010207271 6:73334245-73334267 CCCGGTTCAAGCGATTCTCCTGG - Intergenic
1011364143 6:86562359-86562381 CTGGGTTCAAGCGATTTTCCTGG + Intergenic
1011411934 6:87075064-87075086 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1011597646 6:89031509-89031531 CTGGGTTCAAGTGATTCTCCAGG - Intergenic
1011674616 6:89720313-89720335 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1011760547 6:90560453-90560475 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1011857663 6:91715192-91715214 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1012314918 6:97774079-97774101 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1013458730 6:110356347-110356369 CCGGGTTCAAGCGATTCTTCTGG - Intronic
1013574260 6:111465172-111465194 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1013783259 6:113751826-113751848 CCGGGTTCAAGCGATTCTTCTGG - Intergenic
1014208095 6:118678836-118678858 CCGGGTTCAAGAGATTCTCCTGG - Intronic
1014376152 6:120677443-120677465 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1014634930 6:123833819-123833841 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1014659931 6:124157007-124157029 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1015283996 6:131464226-131464248 CTGGGTTCAAGTGATTTTTCTGG + Intergenic
1015538820 6:134294626-134294648 CAGGGTTCAAGTGATTCTCCTGG + Intronic
1015844669 6:137507499-137507521 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1015851974 6:137583603-137583625 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1015941694 6:138458730-138458752 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1016002511 6:139056662-139056684 CCCGGTTCAAGAGGTTCTCCTGG - Intergenic
1016271220 6:142292766-142292788 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1016503238 6:144746568-144746590 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1016540030 6:145154028-145154050 CCGTGTTCAAGCGATTCTCCTGG - Intergenic
1016549273 6:145258679-145258701 CTGGGTTCAAGCGATTCTCGTGG - Intergenic
1016692546 6:146954753-146954775 CAGGGTTCATGCTGTTTTTCTGG - Intergenic
1017308796 6:152952718-152952740 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1017498501 6:155002772-155002794 CAGGGTTCGAGCAGTTCTCCTGG + Intronic
1017504571 6:155056263-155056285 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1017639312 6:156475562-156475584 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1017752648 6:157502782-157502804 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1017761692 6:157574327-157574349 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1017878309 6:158541997-158542019 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1017937668 6:159020918-159020940 CTGGGTTCACGCCATTTTCCTGG + Intergenic
1017949276 6:159122274-159122296 CGGGGTTCAGGTGATTCTCCTGG + Intergenic
1018205312 6:161431704-161431726 CCGGGTTCAAGAGATTCTCCTGG + Intronic
1018385529 6:163299783-163299805 CCTGGTTCAAGCGATTCTCCTGG - Intronic
1018672534 6:166191688-166191710 CTGGGTTCAAGAGATTCTCCTGG - Intergenic
1020121472 7:5506340-5506362 CCGGGTTGAAGCAGTTCTCCTGG + Intronic
1020162741 7:5784608-5784630 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1020247436 7:6440773-6440795 CCAGGTTCAAGCAGTTCTCCTGG - Intronic
1020510123 7:9046041-9046063 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1020798904 7:12709385-12709407 CTGGGTTCAAGCAGTTCTCGTGG - Intergenic
1020858538 7:13458880-13458902 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1020947934 7:14638942-14638964 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1021139925 7:17011761-17011783 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1021435984 7:20616127-20616149 CAGGGTTCAAGAGATTTTCCTGG + Intronic
1021724181 7:23533667-23533689 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1022679474 7:32530860-32530882 CTGGGTTCAAGCAATTTTCATGG - Intronic
1022889200 7:34678313-34678335 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1023394253 7:39737605-39737627 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1023444164 7:40214818-40214840 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1023445112 7:40223152-40223174 CTGTGTTCAAGCGATTCTCCTGG + Intronic
1023597239 7:41844221-41844243 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1023916660 7:44594921-44594943 CCGGGTTCAAGAGATTCTCCTGG - Intergenic
1024711797 7:52023325-52023347 CTGGGTTCAAGCGATTCTCTGGG - Intergenic
1025077684 7:55957133-55957155 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1025140192 7:56456517-56456539 CCGAGTTCAAGCGATTCTCCTGG - Intergenic
1025803016 7:64805303-64805325 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1025848623 7:65223415-65223437 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1025911623 7:65833256-65833278 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1025977906 7:66384019-66384041 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1025984778 7:66440264-66440286 CTAGGTTCAAGCGATTCTCCTGG + Intergenic
1026046841 7:66911654-66911676 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1026068027 7:67092774-67092796 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1026648092 7:72190250-72190272 CTGGGTTCAGGCGATTCTCCTGG - Intronic
1026708897 7:72719535-72719557 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1026744763 7:73002723-73002745 CTGGGTTCAAGCGATTCTCATGG - Intergenic
1026768608 7:73177413-73177435 CCGGGTTCAAGCAATTCTCCTGG + Intergenic
1026944951 7:74309781-74309803 CCAGGTTCAAGCGATTCTCCCGG - Intronic
1026963868 7:74426986-74427008 CCGGGTTCAAGCAATTTTCCTGG + Intergenic
1027009478 7:74730798-74730820 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1027030870 7:74887395-74887417 CTGGGTTCAAGCGATTCTCATGG - Intergenic
1027078565 7:75215244-75215266 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1027098977 7:75362363-75362385 CTGGGTTCAAGCGATTCTCATGG + Intergenic
1027191935 7:76001585-76001607 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1027203487 7:76078661-76078683 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1027207991 7:76118853-76118875 CTAGGTTCAAGCGATTCTCCTGG + Intergenic
1027257623 7:76441242-76441264 TGGGGCTCAAGCGATTTCCCTGG - Intronic
1027281225 7:76610794-76610816 TGGGGCTCAAGCGATTTCCCTGG + Intronic
1027720147 7:81730359-81730381 CTGAGTTCAAGCCGTTTTCCTGG - Intronic
1027944337 7:84725688-84725710 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1028117216 7:87012314-87012336 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1029251602 7:99240744-99240766 CTGGGCTCAAGCGATTCTCCTGG - Intergenic
1029354570 7:100042223-100042245 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1029358341 7:100069705-100069727 CCGGGTTCAAGTAGTTCTCCTGG + Intronic
1029643965 7:101839853-101839875 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1030022389 7:105288498-105288520 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1030032450 7:105382072-105382094 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1030113185 7:106043403-106043425 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1030237080 7:107275647-107275669 CTGGGTTCATGCGATTCTCCTGG + Intronic
1030260747 7:107561880-107561902 CGGGGTTCACGCCATTCTCCTGG - Intronic
1030301397 7:107977683-107977705 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1030980325 7:116178593-116178615 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1031040683 7:116835597-116835619 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1031060884 7:117050119-117050141 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1031341983 7:120614104-120614126 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1031881496 7:127203612-127203634 CCTGGTTCAAGCGATTCTCCTGG - Intronic
1031965105 7:128022109-128022131 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1032029318 7:128469446-128469468 CTGGGTTCAAGCCATTTTCCTGG + Intergenic
1032204280 7:129848127-129848149 CCGAGTTCAAGCAGTTCTCCAGG - Intronic
1032231550 7:130079149-130079171 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1032541557 7:132707036-132707058 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1032826292 7:135571957-135571979 CCTGGTTCAAGCGTTCTTCCTGG + Intronic
1033296456 7:140141798-140141820 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1033331452 7:140420325-140420347 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1033343539 7:140510242-140510264 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1033507489 7:142019973-142019995 CTGGGTTCAGGCGATTCTCCTGG - Intronic
1033913838 7:146299175-146299197 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1033956804 7:146859561-146859583 CTGCGTTCAAGCGATTCTCCAGG - Intronic
1033977884 7:147124972-147124994 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1034057662 7:148052951-148052973 CTGGTTTCAAGCGATTCTCCTGG - Intronic
1034094535 7:148394865-148394887 GTGGGCTCAAGTGGTTTTCCAGG - Intronic
1034122197 7:148638152-148638174 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1034621082 7:152457581-152457603 CCGGGTTAAAGCGATTCTCCTGG + Intergenic
1034641242 7:152605121-152605143 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1035827920 8:2664401-2664423 CTGGGTTCAAGCAATTTTCCTGG + Intergenic
1036143713 8:6232473-6232495 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1036166297 8:6437322-6437344 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1037953039 8:23031167-23031189 CTGGGTTCAAGAGATTCTCCTGG + Intronic
1038270450 8:26070858-26070880 CCGGGTTCAAGAGATTCTCCTGG + Intergenic
1038552931 8:28485264-28485286 CCAGGTTCAAGCGCTTCTCCTGG + Intronic
1038626476 8:29198413-29198435 CTGGGTTCAAGCGATTCTCCAGG + Intronic
1038729214 8:30112327-30112349 CTGGGTTCAAGCGATTGTCCTGG + Intronic
1038749850 8:30285078-30285100 TGGGGTTCAAGTGATTTTCCTGG + Intergenic
1038789442 8:30655902-30655924 CTGGGCTCAAGCGATTCTCCTGG + Intronic
1038814844 8:30891571-30891593 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1038825963 8:31002575-31002597 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1038890540 8:31717311-31717333 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1039541183 8:38372588-38372610 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1039710038 8:40046458-40046480 CTGGGTTCAAGCAGTTCTCATGG + Intergenic
1039922381 8:41902650-41902672 CTGGGTTCAAGCCGTCTCCCCGG + Intergenic
1040019506 8:42727767-42727789 CTGGGTTCAAGCGATTCCCCTGG - Intronic
1041052592 8:53952169-53952191 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1042232710 8:66574958-66574980 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1042680234 8:71375720-71375742 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1043234349 8:77842948-77842970 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1043451862 8:80375864-80375886 CTGGGTTCAAGCAATTTTCCTGG + Intergenic
1043456763 8:80419538-80419560 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1043581173 8:81716851-81716873 CGGGGTTCAAGTGATTCTCCTGG - Intronic
1043862129 8:85331548-85331570 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1044078507 8:87855194-87855216 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1044312008 8:90704633-90704655 CTGGATTCAAGCGATTCTCCTGG + Intronic
1044738018 8:95299046-95299068 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1045210929 8:100099007-100099029 CCAGGTTCAAGCGATTATCCTGG + Intronic
1045804751 8:106145557-106145579 AGTGGTTCAAGTGGTTTTCTAGG - Intergenic
1045980103 8:108175016-108175038 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1046277617 8:111984250-111984272 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1046361638 8:113166409-113166431 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1046761935 8:118030573-118030595 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1046929936 8:119832063-119832085 CCGGGTTCAAGCTTTTCTCCTGG - Intronic
1046991801 8:120466303-120466325 CCGGGTTCAAGCAATTCTCCCGG + Intronic
1047001643 8:120579081-120579103 CCGGGTTCAAGTGATTCTCCTGG - Intronic
1047093322 8:121597034-121597056 CTGGGTTCAAGGGATTCTCCTGG - Intergenic
1047113185 8:121813633-121813655 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1047987805 8:130253925-130253947 CTGGGTTCAAGCGATTCTCATGG - Intronic
1048098426 8:131319876-131319898 CTGGGTTCAAGCGATTCTCCTGG - Intergenic
1048667503 8:136679437-136679459 CTGGGTTCAAGCGATTCTCTTGG - Intergenic
1049036430 8:140079834-140079856 CCAGGTTCAAGCGATTCTCCTGG - Intronic
1049170938 8:141160270-141160292 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1049385681 8:142341865-142341887 CAGGGTTCGAGTGGGTTTCCTGG - Intronic
1049648648 8:143752057-143752079 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1050007892 9:1152951-1152973 CCGGGTTCAGGCGATTCTCCTGG - Intergenic
1050210060 9:3244093-3244115 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1050436336 9:5614566-5614588 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1050556804 9:6796349-6796371 CCGGGTTCAAGTGATTATCCTGG - Intronic
1051432953 9:16999051-16999073 CTGGGTTCAAGCGATTCCCCTGG - Intergenic
1051450908 9:17196115-17196137 CCAGGTTCAAGCAGTTCTCCTGG + Intronic
1051814739 9:21092188-21092210 CAGGGTTCAAGTGATTCTCCTGG + Intergenic
1052007685 9:23368773-23368795 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1052064488 9:24000191-24000213 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1052905128 9:33827006-33827028 CTGGGTTCAAGCGATTGGCCTGG - Intronic
1053262246 9:36678498-36678520 CTGGGCTCAAGCAGTCTTCCCGG + Intergenic
1054703140 9:68434221-68434243 TTGGGTTCAAGCCATTTTCCTGG - Intronic
1054994454 9:71369595-71369617 CCAGGTTCAAGCGATTCTCCTGG + Intronic
1055917986 9:81426463-81426485 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1056168162 9:83958155-83958177 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1056226026 9:84496196-84496218 CTGGGTTCAAGCGATTATCCTGG + Intergenic
1056438233 9:86594429-86594451 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1056618279 9:88187469-88187491 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1056620325 9:88207033-88207055 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1056643950 9:88393939-88393961 CCGGGTTCAAGCTATTCTCCTGG + Intronic
1056721655 9:89077081-89077103 CTGGGTTCAAGCGATTCTCCTGG - Intronic
1056853513 9:90104618-90104640 CTGGGTTCAAGCGATTCTTCTGG - Intergenic
1056943206 9:90972733-90972755 CCGGGTTCACGCCGTTCTCCTGG - Intergenic
1057012218 9:91614832-91614854 CTGGGTTCAAGCGATTCTCCTGG + Intronic
1057184749 9:93050819-93050841 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1057253926 9:93527714-93527736 CTGGGTTCAAGCAATTCTCCTGG + Intronic
1057787678 9:98099356-98099378 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1058463279 9:105203555-105203577 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1058584231 9:106489506-106489528 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1058677989 9:107417354-107417376 CTGGGTTCAAGCAATTCTCCTGG - Intergenic
1058737429 9:107906784-107906806 CAGGGTTTAAGCGATTCTCCTGG + Intergenic
1058997241 9:110311980-110312002 CCAGGTTCAAGCAGTTCTCCAGG + Intronic
1059153024 9:111966282-111966304 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1059331666 9:113539401-113539423 CTGGGTTCAAGCGATTCTCATGG + Intronic
1059527355 9:115004992-115005014 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1059830729 9:118092854-118092876 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1059936531 9:119316995-119317017 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1060009608 9:120032033-120032055 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1060120791 9:120987542-120987564 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1060310218 9:122452932-122452954 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1060311541 9:122466910-122466932 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1060322439 9:122576313-122576335 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1060390440 9:123272160-123272182 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1060447373 9:123703073-123703095 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1060511230 9:124234261-124234283 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1060512156 9:124241972-124241994 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1060534649 9:124375045-124375067 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1060611587 9:124970627-124970649 CTGGGTTCAAGTGATTCTCCTGG - Intronic
1060800666 9:126543454-126543476 CTGGGTTCAAGCCATTCTCCTGG - Intergenic
1061026090 9:128050739-128050761 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1061029487 9:128071499-128071521 CTGGGTTCAAGTGATTCTCCTGG + Intronic
1061265802 9:129504328-129504350 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1061514354 9:131080064-131080086 CCGGGTTCAAGTGATTCTCCTGG + Intronic
1061797460 9:133095758-133095780 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1061976223 9:134069086-134069108 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1062061696 9:134500282-134500304 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1062458360 9:136651623-136651645 CGGAGTTCAAGCGATTCTCCTGG + Intergenic
1062489418 9:136797912-136797934 CCGGGTTCGAGCGATTCTCCTGG + Intronic
1062659828 9:137624091-137624113 CTGGGCTCAAGTGGTTCTCCTGG + Intronic
1186861348 X:13675313-13675335 CCGGGTTCAAGCCATTCTCCGGG - Intronic
1187442247 X:19330795-19330817 CAGGGTGCAAGCGATTCTCCTGG - Intergenic
1187470585 X:19566016-19566038 CCGGGTTCAAGCGATTCTCCTGG + Intronic
1187869292 X:23751085-23751107 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1187929610 X:24281808-24281830 CTGGGTTCAAGCGACTCTCCTGG + Intergenic
1187949148 X:24455008-24455030 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1188160519 X:26795424-26795446 CTGGGTTCAAGTGATTCTCCTGG + Intergenic
1188347802 X:29088580-29088602 CTGGGTTCAAGCAATTCTCCTGG - Intronic
1188825324 X:34825121-34825143 CCGGGTTCAAGCGATTCTCCTGG + Intergenic
1189323674 X:40100603-40100625 CCGGGTTCAAGCGATTCTCCTGG - Intronic
1189405356 X:40717614-40717636 CCGGGTTCAAGCAATTCTCCTGG + Intronic
1189433542 X:40970835-40970857 CCGGGTTCAAGCCATTCTCCTGG + Intergenic
1189472879 X:41327831-41327853 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1189492007 X:41477255-41477277 CTGGGTTCAAGCGATCCTCCTGG - Intergenic
1189541835 X:41999816-41999838 CTGGGTTCAAGCGATTCTCCTGG + Intergenic
1189810086 X:44773716-44773738 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1190003653 X:46713405-46713427 CCGGGTTCAAGCGATTCTTCTGG - Intronic
1190127210 X:47717166-47717188 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1190219531 X:48502318-48502340 CCGGGTTCAAGTGATTCTCCTGG - Intergenic
1190238817 X:48640350-48640372 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1190617235 X:52246823-52246845 CCAGGTTCAAGCGATTCTCCAGG + Intergenic
1192271293 X:69582097-69582119 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1192290691 X:69791735-69791757 CTGGGTTCAAGCAATTTTCCTGG + Intronic
1192320589 X:70087342-70087364 CCGGGTTCAAGCGATTCTCATGG - Intergenic
1192676963 X:73207916-73207938 CTGGTTTCAAGTGATTTTCCTGG + Intergenic
1193074682 X:77343230-77343252 CTGGGATCAAGCGATTCTCCTGG + Intergenic
1193162110 X:78240244-78240266 CTGTGTTGAAGAGGTTTTCCTGG - Intergenic
1193776295 X:85646400-85646422 CCGGGTTCAAGCAATTCTCCTGG - Intergenic
1194177093 X:90664584-90664606 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1194509105 X:94770268-94770290 CCAGGTTCAAGCGATTCTCCTGG - Intergenic
1194664593 X:96663476-96663498 CCGGGTTCAAGCCATTCTCCTGG - Intergenic
1195977319 X:110541878-110541900 CTGGGTTCAAGCCATTCTCCTGG + Intergenic
1196386555 X:115160220-115160242 CCGGGTTCAAGCAATTCTCCTGG - Intronic
1196648004 X:118139143-118139165 CAAGGTTCAAGCGATTCTCCTGG + Intergenic
1196680962 X:118468968-118468990 CGAGGTTCAAGTGATTCTCCTGG - Intergenic
1196741000 X:119025782-119025804 CTGGGTTCCAGCGATTCTCCTGG - Intergenic
1196829758 X:119766776-119766798 CCGGGTTCAAGCGATTCTCCCGG + Intergenic
1196842643 X:119872315-119872337 CTGGGTTCAAGAGATTCTCCTGG + Intronic
1196932207 X:120693467-120693489 CTGGGTTCAAGCGATTCTCATGG - Intergenic
1196989580 X:121313197-121313219 CTGGGTTCAAGTGATTCTCCTGG - Intergenic
1197253945 X:124243063-124243085 CTGGGTTCAAGCGATTCTCGTGG + Intronic
1197808674 X:130421983-130422005 CTGGGTTCAAGGGATTCTCCTGG + Intergenic
1198111281 X:133504684-133504706 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1198612390 X:138416612-138416634 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1199068595 X:143449616-143449638 CTGGGCTCAAGCGATTCTCCTGG - Intergenic
1199758045 X:150883093-150883115 CCGGCTTCAAGCGATTCTCCCGG - Intronic
1199828991 X:151530234-151530256 CCGGGTTCAAGTGATTCTCCTGG + Intergenic
1199883909 X:151999844-151999866 CCGGGTTCAAGCGATTCTCCTGG - Intergenic
1199989450 X:152977612-152977634 CTGGGCTCAAGCAGTTATCCAGG + Intergenic
1200422714 Y:2988839-2988861 CTGGGTTCAGGCGATTCTCCTGG + Intergenic
1200523764 Y:4246733-4246755 CCAGGTTCAAGCGATTCTCCTGG + Intergenic
1200617364 Y:5396044-5396066 CCGGGTTCAAGCAATTTTCCTGG + Intronic
1200971419 Y:9156375-9156397 TGGGGTTCAAGGGATTCTCCTGG - Intergenic
1201927253 Y:19300741-19300763 CTGGGTTCAAGCAATTTTCCAGG + Intergenic
1201948440 Y:19537136-19537158 CTGGGTTCAAGCAATTCTCCTGG + Intergenic
1202139607 Y:21707933-21707955 GGGGGTTCAAGGGATTCTCCTGG + Intergenic
1202597800 Y:26561443-26561465 CCAGGTTCAAGCGATTCTCCTGG + Intergenic