ID: 1152674861

View in Genome Browser
Species Human (GRCh38)
Location 17:81634545-81634567
Sequence CTAATTCCTAACCTATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152674861 Original CRISPR CTAATTCCTAACCTATTTCT AGG Intronic
902073605 1:13764364-13764386 CTACTTCATAATCAATTTCTAGG - Intronic
904654847 1:32037062-32037084 CAAATTCACATCCTATTTCTGGG - Intronic
906842421 1:49153700-49153722 ATAATACCTAAACTCTTTCTGGG + Intronic
906846497 1:49198280-49198302 CAAATTCCTACATTATTTCTTGG + Intronic
907410368 1:54279346-54279368 CTAATTCCAGACATACTTCTTGG - Intronic
911957390 1:104255255-104255277 CAAATTTCTAACATCTTTCTGGG + Intergenic
914680864 1:149937288-149937310 CTGCTTCCTCACCTAATTCTTGG - Intergenic
917118104 1:171622733-171622755 CTAATTCCTCTTCTGTTTCTTGG + Intergenic
918658286 1:187056357-187056379 TTAATTCCAAACATTTTTCTAGG + Intergenic
918916300 1:190643433-190643455 CTAATTCCTCAGACATTTCTAGG - Intergenic
919720330 1:200826581-200826603 ATAATTCCTGAACTACTTCTAGG - Intronic
922134584 1:222812549-222812571 CTCATGCCTAACCTAATTCTAGG + Intergenic
924033426 1:239910487-239910509 CTAAAACCTCACCTATTCCTGGG - Exonic
924773289 1:247095602-247095624 TTAATTCCCAACCTATTTTGTGG + Intergenic
1064971780 10:21073705-21073727 CTCATACCTAATGTATTTCTAGG + Intronic
1065742225 10:28807474-28807496 CATGTTCCTAACCTATTTATGGG + Intergenic
1073682462 10:105719143-105719165 GTAATTTCTAACCTTTTTTTGGG + Intergenic
1075177426 10:120178670-120178692 CTAAATCCTTTCCTATATCTTGG - Intergenic
1078176217 11:8973242-8973264 CCAATTCCTAAGCCTTTTCTGGG + Intergenic
1079163625 11:18016273-18016295 CTAATTACTAAGCAATGTCTTGG + Intergenic
1079438141 11:20478856-20478878 CTAATTCTAAGCTTATTTCTAGG + Intronic
1080529443 11:33160886-33160908 CAAACTAGTAACCTATTTCTGGG + Intronic
1081121733 11:39274705-39274727 CTAGATCCTTACCTCTTTCTAGG + Intergenic
1081795723 11:45818024-45818046 CTACCTCCTTTCCTATTTCTGGG - Intergenic
1085608203 11:77922004-77922026 CAAATTCCTAACCTGTTGCTTGG - Intronic
1085680220 11:78566574-78566596 ATTAATCCTAACCTATTTGTAGG - Intronic
1088565815 11:111171715-111171737 CTAATTTATAATCTCTTTCTGGG - Intergenic
1090122191 11:124042264-124042286 GTAATTCCTAAACCATTGCTAGG - Intergenic
1093101143 12:15030650-15030672 CTAAATCCTAAATTATTTGTGGG - Intergenic
1093379521 12:18475829-18475851 ATAATTCCCAAGCTATTACTAGG + Intronic
1096805328 12:54137520-54137542 CAAATTCCTGACCTCTATCTAGG + Intergenic
1097687942 12:62708634-62708656 CTAATTCTCAGCCTATTTTTAGG - Intronic
1098865621 12:75759873-75759895 CATATTCCTAACCTCTTTTTAGG - Intergenic
1102209597 12:111116034-111116056 CTAATCCCTCACCCCTTTCTTGG + Intronic
1105583198 13:21720391-21720413 TTACTCCCTAACCTACTTCTGGG + Intergenic
1106137844 13:26987579-26987601 CTAACTCCAAACTTATTTCAAGG - Intergenic
1109190486 13:59317052-59317074 CTAATTCCTAACATAGTATTTGG + Intergenic
1110296427 13:73871689-73871711 CTAATTCCTAACACATCTTTAGG + Intronic
1111883898 13:93994487-93994509 ATAATTCCTAACCTGGTTTTGGG - Intronic
1113440834 13:110326755-110326777 CCGATTCCTAATCTATTTCCTGG + Intronic
1116049234 14:39782612-39782634 CAAACTCCTTTCCTATTTCTGGG - Intergenic
1117697921 14:58385015-58385037 CTACTTCCTGACCTATTTAAAGG - Intergenic
1118601032 14:67471626-67471648 GTATTTCCTAGCCTATTTCCTGG - Exonic
1120329471 14:83072236-83072258 CTAATTGCTAACCTAAGTCAAGG - Intergenic
1120784103 14:88514967-88514989 CCAATTCCTACCCCATTCCTAGG + Intronic
1121562499 14:94885688-94885710 CTAATTCCAATCCTCTTACTAGG - Intergenic
1122044346 14:99012570-99012592 CAAATTCCTAACCCATGGCTGGG - Intergenic
1124130983 15:26985396-26985418 CTAACTCCTGACCTATTTGGGGG - Intronic
1125377846 15:39052304-39052326 CTAATCACTACCTTATTTCTAGG + Intergenic
1126985337 15:54300311-54300333 CAAATTCATCAACTATTTCTTGG - Exonic
1127086088 15:55425782-55425804 GTAATTCACAACCTCTTTCTGGG + Intronic
1127166740 15:56251481-56251503 CTAATTACTAACATCTTCCTTGG - Intronic
1127769247 15:62217625-62217647 CTAACTCCTGAATTATTTCTTGG + Intergenic
1129384658 15:75189339-75189361 CCCATTCCTAACCTAAGTCTGGG - Intergenic
1133384865 16:5361312-5361334 CCACTTCTTAACCTATTTCTGGG - Intergenic
1135210228 16:20519625-20519647 CTACTTACTAACAAATTTCTTGG + Intergenic
1149842056 17:59974075-59974097 CTAATGCCTAATATAGTTCTTGG + Intergenic
1152674861 17:81634545-81634567 CTAATTCCTAACCTATTTCTAGG + Intronic
1158410301 18:57199271-57199293 CTAATTCCTAAAGGGTTTCTGGG + Intergenic
1158468278 18:57711332-57711354 GTAATTCCTACCATATTTATGGG - Intronic
1168335598 19:55595791-55595813 ATCATTCCTCACCTTTTTCTCGG + Intronic
926021010 2:9495745-9495767 CTAATTTATAAAATATTTCTTGG + Intronic
927380256 2:22471417-22471439 CTTATTACTAACCTATTTTTTGG + Intergenic
929071000 2:38030346-38030368 ATAATTCTTATCCCATTTCTAGG + Intronic
931296414 2:60930437-60930459 CTGATTAGTCACCTATTTCTGGG - Exonic
933063314 2:77766630-77766652 TTAATAGCTAACCTATTGCTTGG - Intergenic
936671312 2:114660152-114660174 CTATTTCCTTCCCTGTTTCTTGG - Intronic
936671656 2:114663148-114663170 CTATTTCCTTCCCTATTTCTTGG - Intronic
938295364 2:130175086-130175108 CTGACTCATAACCTATTGCTTGG - Intronic
938461256 2:131498742-131498764 CTGACTCATAACCTATTGCTTGG + Intergenic
938735548 2:134183096-134183118 TTAATTTTTAACCAATTTCTTGG + Intronic
940095869 2:149973613-149973635 CTAAGTCCTATCCTATGTCCAGG + Intergenic
940956768 2:159737620-159737642 CTAATTTTTAAATTATTTCTTGG - Intronic
941379048 2:164768817-164768839 CTATTTCCTTAACTATTTTTAGG + Intronic
941887053 2:170538811-170538833 ATAATTCATCACATATTTCTAGG - Intronic
942150035 2:173066491-173066513 CTAATTCTTAAATTATTTATAGG - Intergenic
942556690 2:177178879-177178901 CTAATTCCTCACCTAGTGTTGGG + Intergenic
942575689 2:177361242-177361264 TTAATTCCTAACGTATTCTTTGG + Intronic
943049598 2:182899164-182899186 ATCATCCCTGACCTATTTCTTGG + Intergenic
947202719 2:227629246-227629268 CTATTTCATAAACTATTTTTTGG - Intronic
948108891 2:235438533-235438555 CTAATTTCTAACCTATAAGTTGG - Intergenic
1169972634 20:11285668-11285690 CAACTTCCTTTCCTATTTCTAGG + Intergenic
1170127480 20:12980853-12980875 CTTTTTCCTCACCTATTCCTTGG - Intergenic
1172068026 20:32235222-32235244 CTACTTCCTAGGCCATTTCTGGG + Exonic
1176588924 21:8621235-8621257 CAAAATCCTACCCTTTTTCTTGG + Intergenic
1177280628 21:18977702-18977724 CTAATTGCTTACATATTTCCAGG - Intergenic
1178182016 21:30172317-30172339 CTAATTCCTAAATTATTTACTGG - Intergenic
1180271751 22:10598232-10598254 CAAAATCCTACCCTTTTTCTTGG + Intergenic
949138396 3:600534-600556 CAAAATCCTACCCTTTTTCTTGG - Intergenic
949269972 3:2203442-2203464 CTCCTTCCTATCATATTTCTGGG + Intronic
950907186 3:16549943-16549965 TAGATACCTAACCTATTTCTAGG + Intergenic
955947878 3:64212769-64212791 CTAGGTCCTACCCTATGTCTAGG + Intronic
960712232 3:120543418-120543440 CTATTTCCTAAAATTTTTCTTGG + Intergenic
966276610 3:178180338-178180360 CTTATTCCTAACATATATGTTGG - Intergenic
967728250 3:192882089-192882111 CTAATGCCTAACCTAAGACTTGG + Intronic
969971943 4:11056899-11056921 CTAATTAATAACCTCTTTGTTGG + Intergenic
970993045 4:22235412-22235434 CTACTTCCTCTCCTATATCTTGG - Intergenic
972076578 4:35097213-35097235 TTAATTTTTAAACTATTTCTAGG + Intergenic
972287820 4:37665607-37665629 ATAATTTCTAACCTAGTTCTTGG - Intronic
972861858 4:43178952-43178974 AAAATACCTAACATATTTCTTGG - Intergenic
973618284 4:52702491-52702513 CTAAATCCTAAATTATTTCCTGG + Intergenic
976185170 4:82436139-82436161 CTTATTTTTAACATATTTCTGGG - Intronic
976520879 4:86024795-86024817 CTAATTCCTATCCTCTGTGTTGG + Intronic
977334517 4:95679578-95679600 CTTTTTCATAACCTATGTCTTGG - Intergenic
978504372 4:109440668-109440690 CTAATTGCTAAGCTCCTTCTAGG - Intronic
978907767 4:114028575-114028597 CCTATTCTTAACCAATTTCTTGG + Intergenic
978970390 4:114796792-114796814 GTGATTCCTACCCTATTTCTTGG - Intergenic
980445675 4:132904253-132904275 CTAATTTTTTACTTATTTCTTGG + Intergenic
982373909 4:154666039-154666061 CTAATACTTAACTTTTTTCTAGG - Intronic
983970983 4:173874093-173874115 CTGTTTCCTAACTTATTTTTGGG + Intergenic
986001249 5:3632767-3632789 CTTATTTCCCACCTATTTCTAGG + Intergenic
988033041 5:25790932-25790954 CTATTTGTTAACCTATTTGTAGG - Intergenic
988693363 5:33594863-33594885 CTTCTTTCTAACCTAGTTCTTGG + Intronic
988833088 5:35005927-35005949 CCACTTCCTATCCTATTCCTAGG + Intronic
990556742 5:56944000-56944022 CTAATTGCTAACCAATATCTTGG + Intronic
991391748 5:66151402-66151424 CTACTTCCAAAGCTCTTTCTAGG - Intronic
991605229 5:68394494-68394516 CTAATATCTAACCTGCTTCTTGG - Intergenic
991640170 5:68743985-68744007 CTAAATGCAATCCTATTTCTAGG - Intergenic
993077513 5:83252883-83252905 CTAAACCCTAACATATTACTCGG - Intronic
994091710 5:95815484-95815506 CTAATTAATAACTCATTTCTTGG - Intronic
995295438 5:110515670-110515692 CCTATTCTTAACCTATTTCATGG + Intronic
995914317 5:117225436-117225458 CTAATTTCAAACCTAGTTCTGGG - Intergenic
996544549 5:124664165-124664187 TTGTTTCCTAACTTATTTCTAGG - Intronic
999351877 5:150879636-150879658 CTAAATACTTACATATTTCTGGG - Intronic
999949788 5:156636499-156636521 ATAATACCTAACTTATGTCTTGG - Intronic
1000203890 5:159038639-159038661 CTCATTCCTAAGCCATTCCTTGG + Intronic
1004415935 6:15424062-15424084 CGCATTCCTAAACTCTTTCTGGG + Intronic
1004830471 6:19472237-19472259 ATATTTCCTAATGTATTTCTAGG + Intergenic
1009772228 6:68158400-68158422 CTAATTCTTAACATGTCTCTTGG + Intergenic
1010109257 6:72205448-72205470 CTAATTTCTAACCTAACTCATGG - Intronic
1013317252 6:108954769-108954791 CCATTTCCTAAGCTCTTTCTGGG + Intronic
1013770506 6:113622854-113622876 CTAATACCTAACCTGTACCTGGG - Intergenic
1017091822 6:150765547-150765569 CTATTAACTAACCTATTTCCGGG + Intronic
1018407298 6:163500734-163500756 CTAATTCATAAAGTATTTGTTGG - Intronic
1019864031 7:3688125-3688147 CTACTTCCTAACTCCTTTCTGGG + Intronic
1020529563 7:9315081-9315103 ATAGTTCCTAAAATATTTCTAGG + Intergenic
1022284141 7:28938968-28938990 CTAAGACCAAACCTGTTTCTTGG - Intergenic
1023128513 7:36978802-36978824 ATAATTGGAAACCTATTTCTAGG - Intronic
1025844700 7:65185831-65185853 CAAATTCCTAACCTGTTGCTTGG + Intergenic
1025895028 7:65692169-65692191 CAAATTCCTAACCTGTTGCTTGG + Intergenic
1027466977 7:78527222-78527244 CTAATCCCTTACCCATTTTTAGG + Intronic
1028060814 7:86312697-86312719 TTAATTCCTCATTTATTTCTTGG + Intergenic
1028199113 7:87939777-87939799 GTAATTTCTAACATACTTCTGGG - Intronic
1029522140 7:101069739-101069761 CTAATTTTTAAACTATTTGTAGG + Intergenic
1034130649 7:148713598-148713620 CTAATTCCTAAGATGTTTATAGG + Intronic
1038881061 8:31612020-31612042 CAAATTCCAGACCCATTTCTAGG - Intergenic
1039312448 8:36332157-36332179 GTATTTCCAAAACTATTTCTTGG - Intergenic
1040973812 8:53167837-53167859 ATAATTCCTAACTCATTGCTTGG + Intergenic
1041695189 8:60728457-60728479 CTAATTCCACACCTATTTTAAGG + Intronic
1042482488 8:69319734-69319756 CTAAATCCTAAAATATTCCTGGG + Intergenic
1042803293 8:72744567-72744589 CTACTTCCTAGCCCATTACTTGG - Intronic
1044902949 8:96968503-96968525 ATAATTATGAACCTATTTCTTGG - Intronic
1046209917 8:111058018-111058040 GAAATTCCTCACTTATTTCTAGG + Intergenic
1046415049 8:113902596-113902618 CTAATTCTTAGCCTGCTTCTAGG - Intergenic
1048098499 8:131321012-131321034 ATAATTCCTAAACAATTTTTTGG - Intergenic
1050918910 9:11174112-11174134 CTAATACCTAACCTTTGGCTGGG - Intergenic
1050962855 9:11758736-11758758 ATAATTCTTAACATATTTTTGGG - Intergenic
1051111653 9:13645299-13645321 TTAACTCCTACCCCATTTCTTGG + Intergenic
1051769165 9:20557584-20557606 CTACTTCCTCACCTATTTCAGGG + Intronic
1052266270 9:26577289-26577311 CTACTTCCTCATCTCTTTCTTGG - Intergenic
1052292653 9:26861207-26861229 CTAGTGCCTAACTTAATTCTGGG - Intronic
1054800837 9:69346841-69346863 TTAATCCCTAATCTTTTTCTAGG - Intronic
1054941660 9:70749372-70749394 TTAATTCCTAGACTATATCTTGG - Intronic
1057779936 9:98041226-98041248 CTAAATCCTAAATTATTTGTGGG - Intergenic
1058256292 9:102768677-102768699 CTAAATGCTAACCTTGTTCTTGG - Intergenic
1059508200 9:114819048-114819070 CTATTTTCTAACCTCTTTCAAGG - Intergenic
1059690798 9:116684437-116684459 CTAAATCCTAAATTATTTGTGGG + Intronic
1060073856 9:120574448-120574470 TAAGTTCCTAACCCATTTCTGGG - Intronic
1203618931 Un_KI270749v1:99815-99837 CAAAATCCTACCCTTTTTCTTGG + Intergenic
1186039955 X:5464799-5464821 TGAATTCTTATCCTATTTCTGGG + Intergenic
1186625933 X:11293668-11293690 CTAATTCCAAAGGTCTTTCTTGG + Intronic
1187265019 X:17723947-17723969 CTATTTACTGATCTATTTCTGGG - Intronic
1188267199 X:28092051-28092073 CTGATTCCTAATCTATGTCAAGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190559599 X:51673838-51673860 CTAGTTACTATCCTATTCCTCGG - Intergenic
1190564692 X:51719483-51719505 CTAGTTACTATCCTATTCCTCGG + Intergenic
1192019567 X:67371487-67371509 TTAATTGCTAACATGTTTCTGGG - Intergenic
1193934434 X:87599604-87599626 CTGATTCCTAAACCATTTATAGG - Intronic
1194213665 X:91100516-91100538 CTCCTTCCCAAACTATTTCTGGG - Intergenic
1196186149 X:112747214-112747236 CTTATCTCTAACTTATTTCTTGG - Intergenic
1196595979 X:117545958-117545980 TAAATTCCTAACTTATTTCTTGG - Intergenic
1198021086 X:132658547-132658569 CTAAATCCTAAAGTATTTTTTGG - Intronic