ID: 1152675293

View in Genome Browser
Species Human (GRCh38)
Location 17:81637017-81637039
Sequence GCGTAGGGAGGCCGGGGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152675293_1152675307 11 Left 1152675293 17:81637017-81637039 CCCCGGCCCCGGCCTCCCTACGC 0: 1
1: 0
2: 1
3: 30
4: 482
Right 1152675307 17:81637051-81637073 CCGCTCCAGCTTCGCCCGCCCGG 0: 1
1: 0
2: 1
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152675293 Original CRISPR GCGTAGGGAGGCCGGGGCCG GGG (reversed) Exonic
900113821 1:1020383-1020405 GCGAGGGGAGGCCGGGGTCCGGG - Intronic
900171914 1:1273509-1273531 GCGCAGGCAGGCTCGGGCCGGGG + Intronic
900176673 1:1294228-1294250 GCGGAGAGGGGCCGGTGCCGTGG - Intronic
900205593 1:1430836-1430858 TGGTCGGGCGGCCGGGGCCGGGG - Intergenic
900244674 1:1631583-1631605 GCGTGGGTAGGCAAGGGCCGCGG - Intergenic
900349729 1:2228650-2228672 GCGGGGGGCGGCCGGGGTCGGGG + Intergenic
900629297 1:3625167-3625189 GCGGGGGGCGGCCGGGGGCGGGG + Exonic
900645253 1:3706112-3706134 GCGGAGGCGGGCCGGGGGCGGGG - Intronic
900996966 1:6127998-6128020 GCGGATGGAGGGCGGGGCTGCGG + Intronic
901022194 1:6261086-6261108 GCGCCGGGCGGCCGGGGGCGGGG + Intergenic
901235458 1:7665111-7665133 GCCTAGGGTGCCCTGGGCCGAGG - Exonic
901486731 1:9568605-9568627 ACTTTGGGAGGCCGAGGCCGGGG + Intronic
901576530 1:10205575-10205597 ACTTTGGGAGGCCGAGGCCGAGG + Intergenic
901784469 1:11615632-11615654 ACTTTGGGAGGCCGAGGCCGGGG + Intergenic
902350116 1:15847980-15848002 GCGCCGGGAGGCGGGTGCCGGGG - Exonic
902921144 1:19666479-19666501 GCGCAGGGAGACCCGGGCTGTGG + Intronic
903468478 1:23568481-23568503 CCGCAGGGACGCTGGGGCCGCGG - Intergenic
904772258 1:32886784-32886806 GCGGATGGAGGCGGGGGCTGGGG + Intronic
905314634 1:37074103-37074125 GCGCACGGAGGCAGGGGCTGGGG + Intergenic
905375004 1:37514381-37514403 GTGGAGGGAGGACGGTGCCGGGG - Intronic
905463073 1:38134004-38134026 GAGGAGGGAGGCGGCGGCCGGGG + Intergenic
908195356 1:61742362-61742384 GGGGAGGGAGCCCGGGGCCGCGG - Intergenic
910288143 1:85576869-85576891 GCGGAGGGAGGCCTGGGCGCGGG + Intronic
910916894 1:92299006-92299028 GCGTAGGGAGGCGGGGCCTCGGG + Exonic
911027159 1:93448051-93448073 GCGGGAGGGGGCCGGGGCCGAGG - Intergenic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
914222505 1:145693522-145693544 ACTTTGGGAGGCCGAGGCCGAGG + Intronic
914753211 1:150549518-150549540 GAGAGGGGCGGCCGGGGCCGGGG - Intronic
915127836 1:153678475-153678497 GCGTGGGGCGGCCGAGACCGGGG + Intergenic
915272078 1:154760624-154760646 TCGTGGAGAGGCCGGGGCCCGGG - Intronic
915616921 1:157046031-157046053 GCGCAGGGAGGCCGGGACAGGGG - Intergenic
916179145 1:162069540-162069562 GCGTCGCGCGGCCGGGGGCGCGG + Intergenic
916315855 1:163446861-163446883 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
918100106 1:181365587-181365609 GCAAGGGGAGGCCTGGGCCGGGG + Intergenic
920331515 1:205211574-205211596 GAGGAGGGAGGCCGGGCCTGCGG - Intergenic
920504733 1:206507817-206507839 GGGTCGGGAGGCCCGGGGCGGGG - Exonic
921060042 1:211578129-211578151 CCTTGGGGAGGCCGTGGCCGTGG + Exonic
922314973 1:224434432-224434454 GGGAGGGGAGGCGGGGGCCGGGG + Intronic
922586076 1:226736193-226736215 GCCTACGGAGGCCAGGGCCCTGG + Exonic
922648803 1:227318743-227318765 GCTGAGGGAGGCCCGGGCGGCGG + Intergenic
922800296 1:228361977-228361999 AGGTGGGGCGGCCGGGGCCGGGG + Intronic
1062873935 10:931104-931126 GCAGGGGAAGGCCGGGGCCGGGG - Intronic
1062916143 10:1242333-1242355 GAGGAGGGAGACGGGGGCCGTGG - Intronic
1064107911 10:12515853-12515875 GCTTTGGGAGGCCGAGGCAGGGG - Intronic
1064169071 10:13013904-13013926 GCTTTGGGAGGCCGAGGCAGGGG + Intronic
1064195791 10:13243168-13243190 GCTTTGGGAGGCCGAGGCAGGGG - Intergenic
1065214690 10:23438858-23438880 GCGGGGCGAGGCCGGGGGCGCGG - Intergenic
1065579476 10:27156112-27156134 TCGTCGGGAGGCCGAGGCAGGGG - Intronic
1068886078 10:62098397-62098419 GCCAAGGGAAGCCGGGGCAGAGG - Intergenic
1071618298 10:87095289-87095311 GCCCAGGGAGGTCGGGGTCGGGG + Intronic
1072656769 10:97335022-97335044 GGGGAGGGAGGCCGCGGCCCAGG - Intergenic
1074108251 10:110404541-110404563 CAGTAGGGAGGCGGGTGCCGAGG + Intergenic
1075206987 10:120456920-120456942 GCGCAGGGAGGCGGCGGCGGCGG + Intergenic
1075645457 10:124093315-124093337 GCGTAGGGAGTCCGGGCCGGCGG - Intronic
1076371606 10:129959301-129959323 GGCGAGGGAGGCCGGGGCCGGGG + Intronic
1076674841 10:132142485-132142507 GGGGAGAGGGGCCGGGGCCGGGG - Intronic
1076859406 10:133133557-133133579 GCCCAGGGAGGCAGGGGACGGGG + Intergenic
1077107797 11:849566-849588 GGGACTGGAGGCCGGGGCCGGGG - Intronic
1077124421 11:926102-926124 GCGGCGTGGGGCCGGGGCCGGGG + Intronic
1077268404 11:1663757-1663779 GCGTAGGGAGGTGGGGCCTGAGG + Intergenic
1077272475 11:1687861-1687883 GCGTAGGGAGGTGGGGCCTGAGG - Intergenic
1078164624 11:8871267-8871289 GGTGAGGGAGGCGGGGGCCGGGG + Intronic
1079034916 11:17013459-17013481 GTGGATGGAGGCCGGGGGCGAGG + Intronic
1079171506 11:18100483-18100505 ACTTTGGGAGGCCGGGGCAGGGG + Intronic
1079172420 11:18108948-18108970 GAGTTGGGAGGCCGAGGCGGTGG - Intergenic
1079202225 11:18385946-18385968 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
1079296836 11:19241694-19241716 GCGCTCGGGGGCCGGGGCCGGGG - Intergenic
1080002307 11:27363358-27363380 GCTAAGGGAGGCCGGGGCGGAGG - Exonic
1080418457 11:32090940-32090962 GCCGGGGGAAGCCGGGGCCGCGG - Exonic
1080582636 11:33656701-33656723 GAGTAGGAAGGCCAGGGCAGTGG - Intronic
1081981558 11:47270081-47270103 GGAGGGGGAGGCCGGGGCCGGGG - Intronic
1083033486 11:59615483-59615505 GCGGCGGGAGGCCCGGGCCCGGG - Exonic
1083246050 11:61429423-61429445 GCGGCGCGAGGCCGGGGGCGGGG - Intronic
1083256110 11:61496365-61496387 GCGTGGGGAGGCTGAGGACGGGG + Intergenic
1083258110 11:61508867-61508889 GCGGGGGAAGGCCGGGGCGGGGG + Exonic
1083329584 11:61891352-61891374 GCGTCGGGGAGCCGGGACCGCGG - Exonic
1083656883 11:64234316-64234338 CCTTGGCGAGGCCGGGGCCGGGG - Intergenic
1083744902 11:64729984-64730006 CAGAAGGGAGGGCGGGGCCGGGG + Intronic
1083746807 11:64741552-64741574 GTGGAGGGAGGCTGGGGGCGGGG + Intronic
1083809426 11:65095491-65095513 ACTTAGGGAGGCCGGGGGGGTGG - Intronic
1084112796 11:67024381-67024403 GAGTAGGGAGGCTGGGGGCTTGG - Intronic
1084204568 11:67584190-67584212 GGGAAGGGAGGCAGGGGCTGGGG + Intronic
1084297229 11:68220694-68220716 GCTTTGGGAGGCCGAGGCGGGGG - Intergenic
1084711129 11:70844344-70844366 GGGTTGGGGGGCCGGGGGCGGGG + Intronic
1084946812 11:72642829-72642851 GGGAAGGGGGGCAGGGGCCGCGG + Intronic
1085608464 11:77924148-77924170 ACTTTGGGAGGCCGGGGCAGGGG + Intronic
1087516419 11:99168317-99168339 ACTTTGGGAGGCCGAGGCCGGGG + Intronic
1089109243 11:116041955-116041977 GAGTAGGGAGGCAGGAGCTGGGG + Intergenic
1089211546 11:116807284-116807306 GCTTTGGGAGGCCGGGGCAGGGG + Intergenic
1090263921 11:125342370-125342392 GAGTAGGGTGGCCGGAGCAGGGG - Intronic
1090793938 11:130117826-130117848 ACTTGGGGAGGCCGAGGCCGGGG + Intronic
1091286592 11:134411866-134411888 GTCTAGGGGCGCCGGGGCCGGGG - Intronic
1091286683 11:134412075-134412097 GGGCAGGGAGGCGGGGGGCGGGG + Intergenic
1091362589 11:134989445-134989467 GTGTGGGGAGGGCGGGGGCGTGG - Intergenic
1091567916 12:1661905-1661927 GCGGCGGGAGGCGGGGGGCGGGG + Intergenic
1091740939 12:2959866-2959888 GCGCAGTGAAGGCGGGGCCGCGG - Intronic
1092385135 12:8031346-8031368 GCTTTGGGAGGCCGAGGCGGGGG - Intergenic
1092462356 12:8697862-8697884 GCGCCAGGAGGGCGGGGCCGGGG + Intronic
1093995326 12:25634994-25635016 ACTTTGGGAGGCCGAGGCCGTGG + Intronic
1096651362 12:53063493-53063515 CTGAAGGGGGGCCGGGGCCGGGG - Intronic
1097046263 12:56189558-56189580 GCGGCGGGAGGCGGCGGCCGCGG - Intronic
1097182160 12:57177746-57177768 GCGTGGGGAGGCCAGGGCCGAGG + Intronic
1097514999 12:60594129-60594151 GCTTAGTGAGGCCCGGGCAGGGG - Intergenic
1097896161 12:64825879-64825901 GCGCTGGGGGGCGGGGGCCGGGG - Intronic
1097990376 12:65826015-65826037 CCGGAGGGAGCCCGGGGCAGGGG + Intronic
1098106141 12:67069911-67069933 GCGTAGGGAGAGCGGCGCGGAGG - Intergenic
1098369150 12:69738895-69738917 GCGTAGTGAGCCCGCCGCCGTGG + Intronic
1101618350 12:106359571-106359593 ACGTTGGGAGGCCGAGGCGGTGG - Intronic
1102128094 12:110501963-110501985 CCGTGGGGAGGCCGAGGGCGAGG - Intronic
1103137100 12:118516971-118516993 TTGTAGGGAGGCCAGGGCAGAGG - Intergenic
1103304643 12:119954403-119954425 ACTTTGGGAGGCCGAGGCCGAGG + Intergenic
1103781567 12:123402274-123402296 CCGGAGCGGGGCCGGGGCCGTGG + Intronic
1103856410 12:123973393-123973415 CCGGAGGGAGGCGGGGGCCGGGG + Exonic
1104021265 12:124993884-124993906 GCGCAGGGGGCGCGGGGCCGCGG + Exonic
1104854342 12:131894978-131895000 GCGCAGGCGGGCCGGGGGCGCGG - Exonic
1104857846 12:131910183-131910205 CCGTGGGGAGGCAGGGGCCTGGG + Intronic
1106447669 13:29850664-29850686 GCGGAGGGAGGACGAGGACGGGG - Exonic
1106517171 13:30465414-30465436 GCGGAGCGCGGCCGGGGCGGCGG - Intronic
1108408003 13:50124289-50124311 GCGTCGGGAGGGGGCGGCCGCGG + Intronic
1108522520 13:51258971-51258993 GCCTGGGCAGGACGGGGCCGGGG + Intronic
1108541686 13:51452332-51452354 GGGGAGGGCGGCCGGGGCGGGGG - Intronic
1109024644 13:57142539-57142561 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109025631 13:57149109-57149131 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109026621 13:57155682-57155704 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109027613 13:57162253-57162275 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109028599 13:57168818-57168840 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1112692808 13:101916329-101916351 CAGAAGGGAGGCCGGGGCCGGGG + Intronic
1113418069 13:110146620-110146642 GGGGAGGGAGGACGGGGCCTGGG + Intergenic
1113517694 13:110915487-110915509 GCCTGGGGCGGCCGGGGGCGGGG + Intergenic
1113760000 13:112840459-112840481 GAGTAGGGAGGCTGAGGCTGGGG - Intronic
1113760021 13:112840524-112840546 GAGTAGGGAGGCTGAGGCTGGGG - Intronic
1114214594 14:20646795-20646817 GCTTTGGGAGGCCGAGGCAGTGG - Intergenic
1115193392 14:30770579-30770601 GAGTGGGGAGGGCGGGGGCGAGG + Intergenic
1115399248 14:32939158-32939180 GCGGGCGGTGGCCGGGGCCGGGG - Intronic
1118332620 14:64825687-64825709 GCTGAGAGAGGCCTGGGCCGTGG + Intronic
1118601555 14:67474006-67474028 GCTTTGGGAGGCCGAGGCGGCGG + Intronic
1119519998 14:75278421-75278443 GCGGGGGGAGGCGGGGGCCGCGG - Intergenic
1121368044 14:93332706-93332728 GCGTGGGGGCGCCGGGGCTGGGG - Intronic
1122082209 14:99273877-99273899 GCGGATGGAGACCGGGGGCGGGG + Intergenic
1122300125 14:100726814-100726836 GCGCACGGAGGCGGGGGCGGGGG + Exonic
1122399130 14:101457353-101457375 GCGCGGGGAGGTCGGGCCCGGGG + Intergenic
1122418373 14:101560974-101560996 GCCGCGGGAGGCCGGGTCCGCGG - Intergenic
1122485264 14:102075375-102075397 GCTAAGGGAGGCCAGGGCTGCGG - Intergenic
1122645135 14:103189147-103189169 GCGCAGGGAGGGCGCGACCGGGG + Intergenic
1122917437 14:104865539-104865561 GCGATGGGAGGCCCGGGCCGCGG - Intronic
1122941998 14:104985666-104985688 GGGCAGGGAGGGCGGGTCCGGGG + Intergenic
1122975180 14:105168130-105168152 GCGGAGGGAGGCGCGGGCCGGGG + Intronic
1122975308 14:105168477-105168499 GCGCTGGGAGGCCGGCGCGGCGG - Exonic
1123794139 15:23754696-23754718 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
1123802747 15:23838595-23838617 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
1124014426 15:25863399-25863421 GCGGAACGAGGGCGGGGCCGTGG - Intronic
1125136941 15:36354440-36354462 ACTTTGGGAGGCCGAGGCCGGGG + Intergenic
1125589515 15:40845585-40845607 GAGTAGGGAGGGCAGGGCCCAGG + Intronic
1127207228 15:56733425-56733447 GCGCAGGGCGGGCGGGGGCGGGG + Intronic
1128077335 15:64835831-64835853 GCGTAGGGAGGCGAGGCCAGAGG + Intergenic
1128252948 15:66176400-66176422 GGGTAGGGAGGCTGGGGTGGAGG + Intronic
1128456021 15:67831905-67831927 GGGGGGGGAGGTCGGGGCCGGGG + Intronic
1128647492 15:69388120-69388142 GAGGAGGGAGGCAGGGGCAGAGG - Intronic
1128747772 15:70126573-70126595 GAGCAGGGAGGCAGGGGCAGTGG - Intergenic
1129948242 15:79560596-79560618 GCGCGGGGAGGCGCGGGCCGGGG + Intergenic
1132105292 15:99058955-99058977 GCGGAGGGAGGGCGGGGGAGGGG - Intergenic
1132255698 15:100373903-100373925 GCGTCGGGAGGCGGGGGGAGGGG + Intergenic
1132679461 16:1133815-1133837 GCCCAGAGAGGCCAGGGCCGGGG + Intergenic
1133197795 16:4183604-4183626 GCGCCAGGAGGCCGAGGCCGGGG - Intergenic
1133212959 16:4273206-4273228 GCGCAGGGGGCCGGGGGCCGCGG + Intergenic
1133332289 16:4982203-4982225 GCGGGGGGAGGGGGGGGCCGAGG - Intronic
1134419389 16:14071542-14071564 GGGCGGGGCGGCCGGGGCCGCGG + Intronic
1134692210 16:16198211-16198233 AAGTGGGGAGGCCGGGGCAGAGG + Intronic
1135521803 16:23183312-23183334 GCGCAGGGAGGGCAGGGCTGCGG + Intronic
1136497093 16:30651329-30651351 GCCTCGGGAGGCTCGGGCCGCGG + Exonic
1136532856 16:30881670-30881692 GCGGAGGGAGGGAGGGGCAGGGG - Intronic
1136723027 16:32339273-32339295 GCACAGGCAGGGCGGGGCCGGGG + Intergenic
1136841347 16:33545272-33545294 GCACAGGCAGGGCGGGGCCGGGG + Intergenic
1137707934 16:50548340-50548362 GCGCGGGGAGGCGCGGGCCGCGG + Exonic
1137900336 16:52260639-52260661 GCTTTGGGAGGCCGAGGGCGCGG - Intergenic
1138004023 16:53313698-53313720 ACTTTGGGAGGCCGAGGCCGAGG + Intronic
1139760692 16:69182460-69182482 GCTTTGGGAGGCCGAGGCGGGGG - Intronic
1139945625 16:70639708-70639730 ACTTAGGGAGGCCGGGGTCGAGG + Intronic
1141456331 16:84144938-84144960 GCGGAGGGGGCCCGGGGCCTGGG + Intronic
1141554976 16:84831102-84831124 GGGTGGGGAGCCCAGGGCCGGGG + Intronic
1141670975 16:85491546-85491568 GCGCAGGGAGGCCTGGCCTGTGG + Intergenic
1142059684 16:88021230-88021252 GCCTGGGGAGGCCGGGCCAGTGG - Intronic
1142142585 16:88479183-88479205 GCGTGGGGAGCCCGGCCCCGCGG - Intronic
1142163319 16:88570586-88570608 GCGGCGGGAGGCCGGGCCGGCGG + Intronic
1142209921 16:88804067-88804089 GCGTGGGGAGACTGAGGCCGGGG + Intronic
1142218511 16:88841590-88841612 CCACAGGGAGGCCGGGGCTGTGG - Intronic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1142395354 16:89828588-89828610 GCGCAGGGCGGCCGGAGCCCTGG + Exonic
1203003404 16_KI270728v1_random:178491-178513 GCACAGGCAGGGCGGGGCCGGGG - Intergenic
1203135012 16_KI270728v1_random:1714898-1714920 GCACAGGCAGGGCGGGGCCGGGG - Intergenic
1203151512 16_KI270728v1_random:1845569-1845591 GCACAGGCAGGGCGGGGCCGGGG + Intergenic
1142623707 17:1179866-1179888 GCGCGGGGCGGCCGGGGCAGGGG + Exonic
1142668251 17:1474780-1474802 ACGTGGGGAGGCCGGGGTGGGGG - Intronic
1142675922 17:1513277-1513299 GCGAAGGCAGGCAGGGGCCCCGG + Intronic
1142972136 17:3619885-3619907 GCGCTGGGAGGCCGGAGCCCAGG - Intronic
1143083160 17:4396439-4396461 GCACAAGGAGGCCGGGGCGGTGG + Intergenic
1143390395 17:6556352-6556374 GCGCGGGGAGGGCAGGGCCGGGG - Intronic
1143578874 17:7812371-7812393 TCTTTGGGAGGCAGGGGCCGGGG + Intronic
1143818187 17:9536990-9537012 GCTTTGGGAGGCCAGGGCGGGGG - Intronic
1143904618 17:10198732-10198754 GCGAGGGCTGGCCGGGGCCGGGG + Intergenic
1144500790 17:15785774-15785796 ACTTTGGGAGGCCGAGGCCGAGG - Intergenic
1144847349 17:18226754-18226776 GCAGAGGGAGGCGGGGGCTGAGG - Intronic
1144953048 17:19004259-19004281 GCGTGGGAAGGACGGGGCTGGGG + Intronic
1145743278 17:27294023-27294045 GCGTCGGGAGGCGGGGGCCTCGG + Intergenic
1146142389 17:30379181-30379203 GCTGAGGGAGGCGGCGGCCGCGG + Exonic
1146547553 17:33751921-33751943 GCTTAGGGAAGCCGGGGGTGGGG + Intronic
1147139646 17:38453925-38453947 GCGTACTGGGGCCGGGGCAGTGG + Intronic
1147204226 17:38825139-38825161 GTGGAGGGAGGCCTGGGCGGGGG - Intronic
1147392979 17:40121822-40121844 GCGAGGGGAGGCCGGGGCTGAGG - Intergenic
1147648905 17:42050781-42050803 GCGTGGGGCGGCAGGGGCTGGGG - Intronic
1147742496 17:42676938-42676960 GCGTCCGGTGGCCGGGGCCCGGG + Exonic
1147759698 17:42789410-42789432 ACTTTGGGAGGCCGAGGCCGAGG + Intronic
1147824887 17:43264063-43264085 GCTTTGGGAGGCCGAGGCGGCGG - Intergenic
1147907560 17:43832939-43832961 GAAGAGGGAGGCGGGGGCCGAGG + Intronic
1148052517 17:44776063-44776085 GCCTGGGGAGGGCAGGGCCGAGG + Intronic
1148058414 17:44816747-44816769 ACGTTGGGAGGCCGAGGCAGAGG - Intronic
1148374824 17:47133686-47133708 ACTTTGGGAGGCCGAGGCCGAGG - Intronic
1148388551 17:47253874-47253896 GCCCAGAGCGGCCGGGGCCGCGG - Intergenic
1148452628 17:47789985-47790007 GCGCAGCGAGCCTGGGGCCGGGG - Intergenic
1148745820 17:49917529-49917551 ACTTTGGGAGGCCGAGGCCGAGG - Intergenic
1148872535 17:50667307-50667329 GCCTGGGGAGGCCGGTGCAGTGG + Intronic
1149772364 17:59331898-59331920 GAGTCCGGAGGCCGGGGCCGGGG - Intronic
1149994634 17:61400137-61400159 GCGCCCGGGGGCCGGGGCCGGGG - Exonic
1150261988 17:63801297-63801319 GCTTTGGGAGGCCGAGGCAGGGG - Intronic
1151797054 17:76353503-76353525 GCGGTGGGAGGGCCGGGCCGGGG - Intronic
1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG + Intronic
1152070688 17:78132315-78132337 GGTCAGGGAGGCCGGGGCCGGGG - Intronic
1152353914 17:79797731-79797753 GGGGAGGGGGGCGGGGGCCGGGG - Intronic
1152548882 17:81019465-81019487 GCGTGGGGAGGTGGGGGCAGAGG + Intergenic
1152675293 17:81637017-81637039 GCGTAGGGAGGCCGGGGCCGGGG - Exonic
1152930779 17:83108538-83108560 GCGTAGGGGGGACGGGGCTCTGG + Intergenic
1153469487 18:5427997-5428019 ACTTTGGGAGGCCGGGGGCGGGG - Intronic
1154151370 18:11908837-11908859 GCGTCAGGAGGCCGGGCGCGCGG - Exonic
1154500907 18:14997537-14997559 GCTTAGCGTGGCCGTGGCCGTGG - Intergenic
1155263197 18:24065168-24065190 TGGCAGGGAGGCCTGGGCCGAGG + Intronic
1155910339 18:31498155-31498177 CCGGGGGGAGGCCGGGGCCAGGG + Exonic
1156871949 18:41955398-41955420 GCGTAGGGACGTGGGGGCAGGGG + Intronic
1157565583 18:48676994-48677016 TGGGCGGGAGGCCGGGGCCGCGG + Intronic
1157908990 18:51597573-51597595 GCTTAGGGAGGCCTAGGCAGGGG - Intergenic
1158934488 18:62352038-62352060 GCTTTGGGAGGCCGAGGCGGGGG - Intronic
1160577979 18:79867789-79867811 GTCCAGGGAGGCCGGTGCCGAGG - Intronic
1160703443 19:518569-518591 GAGGAGGGAGGCCTGGGCTGGGG + Intronic
1160775425 19:853092-853114 GTGGGGGGAGGCCGGGGCCGGGG + Intronic
1160793376 19:933103-933125 GGGCAGAGAGGCCGGGGCCTTGG + Intronic
1160806885 19:995898-995920 GCGGAGGGGGGCAGGGGTCGTGG - Intronic
1160858770 19:1228919-1228941 GCGTCGTGAGGCGCGGGCCGCGG - Exonic
1160928061 19:1556346-1556368 GCGGAGGCCGGCCGTGGCCGTGG + Exonic
1161065647 19:2236099-2236121 GGGGCGGGAGGCCGGGGCCGGGG - Intronic
1161275854 19:3416765-3416787 GCTTTGGGAGGCCGAGGCGGTGG - Intronic
1161286545 19:3471315-3471337 GGGGAGGGAGGCTGGGGCCCGGG + Intergenic
1161289032 19:3483080-3483102 GAGGAGGGTGGCCGGGGCCGGGG - Intergenic
1161388208 19:4007954-4007976 GGGCGGGGAGGCCGGGGGCGGGG + Intronic
1161779130 19:6279680-6279702 GAGCGGGGAGGCCGGGACCGGGG + Intronic
1161964696 19:7541545-7541567 GAGTTGGGAGGCCGGGGCTGGGG - Exonic
1162022381 19:7873812-7873834 GCGGATGGAAGCCGAGGCCGAGG - Intronic
1162350499 19:10146073-10146095 GCTTTGGGAGGCCGAGGCAGTGG - Intronic
1162906003 19:13824485-13824507 GATTTGGGAGGCCGAGGCCGGGG + Intronic
1163312413 19:16522240-16522262 GGTTGGGGAGGCCAGGGCCGGGG - Intronic
1163433460 19:17281978-17282000 CCGTGGTGAGGGCGGGGCCGGGG + Exonic
1163462815 19:17448844-17448866 GCTTAGGGCGGCAGGGGGCGGGG - Intronic
1163612202 19:18307531-18307553 GTGTTTGGTGGCCGGGGCCGAGG - Exonic
1163765836 19:19162769-19162791 GCACAGAGAGGCCAGGGCCGGGG + Intronic
1165763420 19:38335914-38335936 GCGGGGGGATGCCGGGGACGGGG + Intronic
1165770150 19:38375194-38375216 GCTTTGGGAGGCCGAGGCGGGGG + Intronic
1166055322 19:40284989-40285011 GCCTCGGGGGGCCGGGGCGGTGG - Intronic
1166283687 19:41810845-41810867 GGGTAGGGGGGCCTGGGCAGTGG - Exonic
1166310397 19:41959164-41959186 GAGGAGGGAGGAGGGGGCCGGGG + Intronic
1167126897 19:47555676-47555698 GCGTTGGGAGGCTGGGGTCCGGG + Exonic
1167492934 19:49802292-49802314 GAGCAGGGAGGCTGGGGCAGGGG - Intronic
1167596811 19:50432360-50432382 GCGTAGGCAGGACGGCGGCGGGG - Intergenic
1167768331 19:51499047-51499069 GCTGAGGGAGGGGGGGGCCGGGG + Intronic
1167971997 19:53193432-53193454 GCATAGGGTGGGCGGGGCCGGGG + Intergenic
1168064004 19:53909322-53909344 GCCGAGTGAGGCCGCGGCCGCGG + Exonic
1168217492 19:54936966-54936988 ACTTTGGGAGGCCGAGGCCGAGG + Intronic
1168278130 19:55288116-55288138 GCGTAGGGAGGCAGGGCCATGGG + Intronic
925928243 2:8685581-8685603 GCAGAGGTCGGCCGGGGCCGCGG - Intergenic
926095672 2:10079758-10079780 GGGCGGGGAGGCCGGGGCAGCGG + Intronic
926150917 2:10425172-10425194 AAGTGGGGAGGCTGGGGCCGTGG + Intronic
927472362 2:23385727-23385749 GCGCAGAGAGCCCGGGGTCGCGG - Exonic
927920835 2:26970887-26970909 GGGTGGGGAGGCAGGGGCGGGGG - Intronic
927949233 2:27156077-27156099 ACTTTGGGAGGCCGGGGTCGGGG + Exonic
928388325 2:30888628-30888650 GGGTTGGGAGGCCGGGGGTGGGG + Intergenic
930798912 2:55421860-55421882 CCTTAGGGAGGCCGAGGCGGTGG - Intergenic
931763732 2:65436796-65436818 GAGGAGGGAGGCGGGGGCAGGGG - Intergenic
932119748 2:69087759-69087781 GGGTAGGGAGGCCCGGGCAGTGG - Intronic
932420073 2:71596386-71596408 GCGTAGGGAAGCACGGGGCGGGG + Intronic
933710155 2:85319418-85319440 GCTTTGGGAGGCCGAGGCGGGGG - Intronic
934604347 2:95682753-95682775 GCGAGGGGAGGGCGGGCCCGAGG - Intergenic
935236926 2:101147066-101147088 GCTTTGAGAGGCCGAGGCCGAGG + Intronic
936511659 2:113153217-113153239 ACTTTGGGAGGCCGAGGCCGGGG + Intergenic
936537742 2:113324985-113325007 GCGAGGGGAGGGCGGGGCCGAGG - Intergenic
937325256 2:120986360-120986382 GCGTGGAGATGCCGGGGACGGGG + Exonic
937355913 2:121197949-121197971 GCGTGGGCAGGCCGGGGGTGTGG - Intergenic
938786029 2:134630688-134630710 GGGTAGGGAGGGAGGGGCCCAGG - Intronic
939021534 2:136963396-136963418 GCTTAGGGAGGCCGAGGGTGGGG + Intronic
939560129 2:143721935-143721957 ACTTTGGGAGGCCGAGGCCGAGG - Intronic
945088891 2:206160147-206160169 AGGGAGGGAGGCCGGGCCCGGGG + Intronic
946354532 2:219176721-219176743 GCGCCGGGAGGCCGGGGAGGGGG + Intronic
946431779 2:219630164-219630186 GAGTCGGGAGGCCCGGGCCCGGG - Exonic
947853551 2:233307697-233307719 CCGTATGGAGACCGGGGCGGGGG + Intergenic
948421954 2:237865236-237865258 GAGTAGGGAGGGCAGGGCAGGGG + Intronic
1168750602 20:278929-278951 GCGGAGGGAGGGCGGGACGGAGG + Intronic
1169171802 20:3471217-3471239 GGGCTGGGAGGCCGGGGCTGGGG + Exonic
1170898865 20:20440725-20440747 GCCAAGGAAGGCCCGGGCCGGGG - Intronic
1172149472 20:32780049-32780071 GAGTGGGGAGGCCAGGGCTGGGG - Intronic
1172763881 20:37340607-37340629 GCGGAAGGAGGCCTGGGCTGGGG + Intergenic
1172984438 20:38972253-38972275 ACTTTGGGAGGCCAGGGCCGGGG - Intronic
1173251427 20:41366079-41366101 GAGAAGGGAGGCCCGGGGCGGGG + Intronic
1175517252 20:59577472-59577494 GCGGAGCGGAGCCGGGGCCGCGG - Intergenic
1178491682 21:33056542-33056564 ACTTTGGGAGGCCGAGGCCGGGG + Intergenic
1179802141 21:43816178-43816200 GGAGAGGGAGGCAGGGGCCGGGG - Intergenic
1179918837 21:44496138-44496160 GCATAGGGAGGTCGGGGGCCTGG + Intergenic
1180695014 22:17746219-17746241 CAGTAGGGAGGCGGGGGCGGGGG + Intronic
1180791487 22:18577714-18577736 GCGGGCGGGGGCCGGGGCCGCGG - Intergenic
1180801528 22:18634205-18634227 GCGTGCGGGGGCCGGGGCGGCGG + Intergenic
1181220194 22:21361056-21361078 GCGTGCGGGGGCCGGGGCGGCGG - Intergenic
1181230252 22:21417597-21417619 GCGGGCGGGGGCCGGGGCCGCGG + Intronic
1181248398 22:21517266-21517288 GCGGGCGGGGGCCGGGGCCGCGG - Intergenic
1181280584 22:21717119-21717141 ACTTTGGGAGGCCGGGGCTGGGG + Intronic
1181293344 22:21815304-21815326 ACTTTGGGAGGCCGAGGCCGAGG - Intronic
1181593071 22:23896485-23896507 GCCTTGGGAGGCTGGGGCTGGGG - Intronic
1181700235 22:24616787-24616809 ACTTTGGGAGGCCGAGGCCGGGG - Intronic
1182106795 22:27695463-27695485 GCCCAGGGAGGCCGAGGCTGTGG + Intergenic
1182184190 22:28384894-28384916 ACTTTGGGAGGCCGGGGACGGGG + Intronic
1183437735 22:37805062-37805084 GAGCAGGAAGGCCCGGGCCGGGG + Intergenic
1183612549 22:38920006-38920028 GAATAGGGAGGCCAGGGCAGAGG + Intergenic
1183956282 22:41382258-41382280 GCCTCGTGAGGGCGGGGCCGGGG + Intronic
1184587781 22:45459456-45459478 TCGGAGGGAGGGCGGGGCTGGGG + Intergenic
1184796807 22:46737830-46737852 CGGGAGGGAGGCCGGGGCCAGGG - Intronic
1185038064 22:48489919-48489941 GGGAAGGGAGGCTCGGGCCGGGG - Intronic
1185409462 22:50674491-50674513 GCCGGGGGGGGCCGGGGCCGGGG - Intergenic
949559429 3:5188112-5188134 GTGCTGGGCGGCCGGGGCCGCGG + Exonic
950182848 3:10927274-10927296 GCAGAGGGAGGCAGGGGCTGGGG + Intronic
950436381 3:12982964-12982986 GCAGAGGGAGGCCCTGGCCGTGG + Intronic
952748989 3:36809247-36809269 ACTTTGGGAGGCCGAGGCCGAGG + Intergenic
952759861 3:36904284-36904306 ACTTCGGGAGGCCGAGGCCGAGG + Intronic
953117723 3:40009484-40009506 ACTTTGGGAGGCCGAGGCCGAGG - Intronic
953769259 3:45766100-45766122 GAGGAGGGAGGGCGGGGCCAGGG + Intronic
954130141 3:48556610-48556632 GGGTAGGGCGGCCTGGGCGGGGG - Intronic
954305705 3:49724217-49724239 TCGGGGCGAGGCCGGGGCCGTGG - Intergenic
954702024 3:52455545-52455567 GCGACGGGCGGCGGGGGCCGGGG + Exonic
955348696 3:58178984-58179006 GCGCAGGCAGGGCGGGGCAGGGG - Intergenic
960978491 3:123200347-123200369 ACTTTGGGAGGCCGGGGGCGGGG - Intronic
961664895 3:128488885-128488907 TCGAAGGGAGCCCCGGGCCGAGG + Intronic
961772353 3:129259216-129259238 GCTTTGGGAGGCCGAGGCAGGGG + Intronic
962224737 3:133596515-133596537 ACTTTGGGAGGCCGAGGCCGAGG - Intergenic
963189016 3:142448132-142448154 GCCTCGCGCGGCCGGGGCCGCGG + Intergenic
965265057 3:166532159-166532181 GAGTAGGGAGGCCCTGGCCCTGG + Intergenic
965374289 3:167903165-167903187 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
966711915 3:182980407-182980429 ACGGAGGGCGGCCGGGGCGGGGG + Intronic
966793343 3:183692767-183692789 ACTTTGGGAGGCCGAGGCCGAGG + Intergenic
966815209 3:183884806-183884828 GCGCAGAGAGGCTGGGGCTGCGG - Exonic
966874656 3:184315133-184315155 CCGGAGGGCGGGCGGGGCCGGGG - Intronic
966886452 3:184380189-184380211 GCGGGAGGGGGCCGGGGCCGGGG - Exonic
967762336 3:193240593-193240615 GCGGAGGGGGGCCGGGGGAGGGG + Intergenic
968092809 3:195909102-195909124 GCGCGGCGAGGCCCGGGCCGGGG - Intronic
968170172 3:196503698-196503720 GCGTAGGAGGGACGGGGGCGCGG - Exonic
968674652 4:1871158-1871180 GCGCCGGGAGGGCCGGGCCGCGG - Intergenic
968764893 4:2463033-2463055 AGGCAGGGGGGCCGGGGCCGAGG - Intronic
968850325 4:3074111-3074133 GGGTGGGGAGGCTGGGGGCGGGG - Intergenic
969441968 4:7222642-7222664 GGGTAGTGCGGCCGGGGCAGAGG + Intronic
969756397 4:9153107-9153129 GCGTTAGGAGGGCGGGGCCTGGG - Intergenic
970333313 4:15004749-15004771 GCGTCGGGGGTCCGGGGCGGCGG - Intronic
972606672 4:40619951-40619973 ACTTCGGGAGGCCGAGGCCGCGG + Intronic
972765860 4:42151956-42151978 GCGAAGGGCGGCGGGGGCGGCGG + Exonic
973236311 4:47909903-47909925 ACTTTGGGAGGCCGAGGCCGGGG - Intronic
973292488 4:48483817-48483839 GCGTGGGGCGCCCAGGGCCGAGG - Exonic
974326628 4:60422821-60422843 GTGTATGGAGGCGGGGGGCGGGG - Intergenic
975540029 4:75499766-75499788 GGGTAGGGAGGATGGGGCAGGGG + Intronic
975542173 4:75525000-75525022 ACTTAGGGAGGCCGAGGCAGGGG - Intronic
975702023 4:77075781-77075803 CCATAGGGCGGCGGGGGCCGGGG + Exonic
975778933 4:77819539-77819561 GCGCAGGGAACCCGGGCCCGGGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978673000 4:111273693-111273715 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
978802065 4:112764584-112764606 ACTTTGGGAGGCCGAGGCCGAGG - Intergenic
979738301 4:124117556-124117578 GCTTTGGGAGGCCGAGGCGGCGG + Intergenic
980075218 4:128287535-128287557 GGGTCTGGGGGCCGGGGCCGGGG - Exonic
982184098 4:152779329-152779351 GCTCAGGGATGCCGGGCCCGGGG + Intronic
982717874 4:158827825-158827847 GCCAAGGGAGGCTGGGGCGGTGG - Intronic
983534036 4:168838460-168838482 GGGGAGGGAGTGCGGGGCCGGGG + Intronic
984411267 4:179401358-179401380 ACTTTGGGAGGCCGGGGCCGGGG - Intergenic
984898148 4:184560367-184560389 ACTTAGGGAGGCCGAGGCGGGGG + Intergenic
985688644 5:1295059-1295081 GCGAGGAGAGGGCGGGGCCGCGG + Intronic
985805105 5:2037970-2037992 ACTTTGGGAGGCCGCGGCCGCGG - Intergenic
985819231 5:2148483-2148505 GCGCAGGTAGGCCAGGGCGGGGG - Intergenic
986300570 5:6475662-6475684 GGGTAGGAAGGCAGGGCCCGGGG + Intronic
986321240 5:6633877-6633899 GGGTAGGGGGCCGGGGGCCGGGG - Intronic
986929920 5:12805354-12805376 GCGTCTGGAGGCTGGGGGCGGGG - Intergenic
988559445 5:32267130-32267152 ACTTTGGGAGGCCGAGGCCGTGG + Intronic
989010949 5:36872401-36872423 ACTTTGGGAGGCCGAGGCCGGGG + Intergenic
989209675 5:38846364-38846386 AGGTAGGCAGGCCGGGGGCGAGG - Exonic
992167730 5:74071436-74071458 GCTTTGGGAGGCCAAGGCCGGGG - Intergenic
994284005 5:97941322-97941344 GCTTTGGGAGGCCGAGGCGGGGG - Intergenic
996443062 5:123512761-123512783 GCGTGGGCAGGAGGGGGCCGCGG + Intronic
997194181 5:131966742-131966764 GCCTAGGGTGGCCAGGGCAGGGG - Intronic
997302007 5:132813418-132813440 GCGAAGGGCGCCGGGGGCCGCGG - Intergenic
997614460 5:135237003-135237025 GTGTAGAGAGGAAGGGGCCGAGG + Intronic
999997115 5:157102688-157102710 GCTTTGGGAGGCCGAGGCAGAGG + Intronic
1001648337 5:173298356-173298378 GCGAAGGGAGGCTGGGCCTGTGG - Intergenic
1002166603 5:177351554-177351576 GTGTAGTGGGGCCAGGGCCGGGG + Exonic
1002321031 5:178376064-178376086 GAGTAGGGAGGCAGGGCCAGGGG - Intronic
1002888177 6:1313432-1313454 GCGGGGCGAGGCCGGGGCGGCGG - Exonic
1003171507 6:3724962-3724984 GCATAGGGAAGCCGAGGCGGGGG - Intronic
1003487913 6:6595527-6595549 GCGTAGAGAGGATGGGGCTGGGG - Intronic
1003545183 6:7052439-7052461 GCGCAGGGAAGCCGGGGGTGGGG + Intergenic
1004395688 6:15245238-15245260 GGGGAGGGGGGCCGGGGCCCGGG + Intergenic
1004492327 6:16128939-16128961 GCTCTGGGAGGCGGGGGCCGCGG + Intergenic
1005477847 6:26225763-26225785 GCGTAGGGAGGCCCAGCCCTAGG - Intergenic
1005953311 6:30647120-30647142 GGGAAAGGAGGCCGGGGCGGGGG - Exonic
1006441484 6:34056377-34056399 GAGTTGGGAGGCCTGGGGCGGGG - Intronic
1006642466 6:35496420-35496442 GCGCTGGGAGGCCGGGCCCGAGG + Intronic
1006763633 6:36485734-36485756 ACTTAGGGAGGCCGAGGCGGCGG - Intronic
1007118548 6:39361772-39361794 GCGTCGGGGGGCAGGGGCGGTGG + Intronic
1007547087 6:42702617-42702639 ACTTTGGGAGGCCGAGGCCGAGG + Intronic
1007784082 6:44270520-44270542 GCCGGGGGGGGCCGGGGCCGGGG - Exonic
1011453823 6:87525788-87525810 ACTTTGGGAGGCCGGGGGCGCGG - Intronic
1011482625 6:87810436-87810458 GCTTTGGGAGGCCGAGGCGGCGG - Intergenic
1011769065 6:90655398-90655420 GGATAGGGAGGGAGGGGCCGGGG - Intergenic
1013242711 6:108260938-108260960 GCGGAGGGAGCCCGCGGCGGCGG - Exonic
1015625894 6:135181067-135181089 GGGCAGGGAGCCCGGGGCCAGGG - Intergenic
1016368282 6:143342264-143342286 GCGCAGAGAGGCTGGGGCTGCGG + Intergenic
1018091234 6:160348249-160348271 GGGAAGAGAGGCGGGGGCCGCGG + Exonic
1018103052 6:160458263-160458285 GCGTAGGGAGTCTGGGGCCCTGG - Intergenic
1019331701 7:463602-463624 CCGCAGTGGGGCCGGGGCCGCGG - Intergenic
1019779537 7:2931202-2931224 GCAGAGGGAGGCCAGGGCGGGGG - Intronic
1020142652 7:5621070-5621092 GCGCAGGGAGGCCGGGCTTGGGG - Intronic
1020381928 7:7556911-7556933 GTGTGGGGAGGCTGGGGCCCTGG - Intergenic
1021716542 7:23468029-23468051 GGGTTGGGAGGCCGTGGGCGCGG - Intronic
1022207966 7:28180812-28180834 GCGGGGGGAGGGCGGGGGCGGGG + Intergenic
1022716860 7:32906483-32906505 GCCCAGGGAGGTCGGGGCTGCGG + Intergenic
1023258950 7:38339511-38339533 ACTTAGGGAGGCCGAGGCAGGGG + Intergenic
1023287033 7:38631153-38631175 GCGGAGCGGGGCCGGGGCCAGGG - Intronic
1023287070 7:38631256-38631278 GCGGCGGGCGGCCGGGGCTGGGG - Intronic
1024579876 7:50793100-50793122 GCGCTGGGCGGCCGCGGCCGGGG - Intronic
1025097292 7:56106279-56106301 GCAGAGGGAGGCCGCGGGCGGGG - Intronic
1025829673 7:65038342-65038364 GCGGAGGGAGGCGGTGGCGGCGG + Intergenic
1025916924 7:65873339-65873361 GCGGAGGGAGGCGGCGGCGGCGG + Intronic
1026140253 7:67699479-67699501 GCTCAGGGAGGAGGGGGCCGTGG + Intergenic
1026546850 7:71330644-71330666 GCTTTGGGAGGCCGAGGCAGAGG - Intronic
1026920620 7:74152788-74152810 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
1027559225 7:79706270-79706292 ACTTTGGGAGGCCGAGGCCGGGG - Intergenic
1028484809 7:91346072-91346094 ACGTTGGGAGGCCGAGGCGGTGG - Intergenic
1029432411 7:100539620-100539642 GGGTGGGGAGGCCGGGGCTCCGG + Intronic
1029457778 7:100679683-100679705 GCCCAGGAAGACCGGGGCCGGGG + Exonic
1029461137 7:100694370-100694392 GCGGAGGGAGGCGGCGGCGGCGG - Intergenic
1029506511 7:100966564-100966586 GCGTGCGGGGGGCGGGGCCGGGG + Intronic
1030060941 7:105620783-105620805 TCGTAGGGAGGCTGAGGCAGGGG + Intronic
1030121112 7:106111973-106111995 GGGCAGGGAGGCCGCGGCCTGGG - Intronic
1030682680 7:112450223-112450245 ACGTAGTAAGGCTGGGGCCGGGG - Intronic
1031317272 7:120273371-120273393 GCGCGGTGGGGCCGGGGCCGGGG - Intergenic
1032159983 7:129502667-129502689 GCGTAGTGAGGCTGGGCCCGTGG + Exonic
1032193491 7:129777462-129777484 GTGGAGGGAGGCTGGGGCCTGGG + Intergenic
1032359898 7:131245522-131245544 ACTTTGGGAGGCCGAGGCCGGGG - Intronic
1033159134 7:138981371-138981393 GCGGAGGGAGGCCGGAGAGGCGG + Intergenic
1033656739 7:143380545-143380567 GAGGTGGGAGGGCGGGGCCGAGG - Intergenic
1033753741 7:144380200-144380222 ACGAAAGGAGGCCTGGGCCGAGG - Exonic
1034179388 7:149126094-149126116 GAGTGGGGCGGCCGGGGCCTGGG - Intronic
1034227857 7:149497269-149497291 GCGTGGGGCGGCCCGGGGCGGGG + Intronic
1034243027 7:149624315-149624337 GCGTGGGGCGGCCCGGGGCGGGG + Intergenic
1034263819 7:149772291-149772313 GGGAAGGGAGGCGGGGGCCTCGG - Intronic
1034441121 7:151086585-151086607 GCGCATGGAGCCGGGGGCCGGGG - Intronic
1035590052 8:805766-805788 GCTTTGGGAGGCCGAGGCCAAGG - Intergenic
1035740591 8:1925405-1925427 GTGAAGGGAGGCAGGGCCCGCGG + Intronic
1035865562 8:3077691-3077713 GTGTAGGCAAGCCGGGGTCGGGG - Intronic
1036499235 8:9297952-9297974 GCCTAGGGAAGCAGGGGCCTTGG + Intergenic
1036513571 8:9422613-9422635 ACTTTGGGAGGCCGAGGCCGGGG + Intergenic
1036849933 8:12194238-12194260 GCGTTAGGAGGGCGGGGCCTGGG + Intergenic
1036871297 8:12436511-12436533 GCGTTAGGAGGGCGGGGCCTGGG + Intergenic
1037939906 8:22943648-22943670 ACTTAGGGAGGCCGAGGCGGGGG - Intronic
1038312889 8:26458513-26458535 ACGTTGGGAGGCCGAGGCAGGGG + Intronic
1038319348 8:26513685-26513707 GCGGAGGTGGGCCGGGGGCGAGG - Intronic
1038540350 8:28385871-28385893 GGTCTGGGAGGCCGGGGCCGCGG - Intronic
1039417848 8:37410721-37410743 GCCTAGGGAGGCTGGGGTCACGG + Intergenic
1040471495 8:47738407-47738429 GCGCAGGCCGGCCCGGGCCGGGG - Exonic
1040939146 8:52815211-52815233 GCTTAGGAAGGCAGGGGGCGGGG - Intergenic
1041720169 8:60968263-60968285 ACTTTGGGAGGCCGAGGCCGAGG + Intergenic
1042266452 8:66913719-66913741 ACTTTGGGAGGCCGGGGCAGCGG + Intronic
1044250715 8:90001560-90001582 GGGTAAGGCGGCCGGGGGCGCGG + Exonic
1045098988 8:98825987-98826009 GCGGCGGGTGGGCGGGGCCGGGG + Intronic
1045541945 8:103094887-103094909 GAATAGGGAGGCCGGAGCAGGGG + Intergenic
1047951474 8:129939400-129939422 CCGGGGGCAGGCCGGGGCCGCGG + Intronic
1048214350 8:132481149-132481171 GCGGCGGGAGGCCCGGGCGGCGG + Intergenic
1049463147 8:142739335-142739357 GCGTGGGGAGGCCACGGCCAGGG - Intergenic
1049507117 8:143008709-143008731 GCGTGGCCAGGCCGGGGCCCTGG + Intergenic
1049778959 8:144418775-144418797 GCTGTGGGAGGCCGGGGCGGGGG + Intergenic
1052845695 9:33334208-33334230 GCTTTGGGAGGCCAGGGCTGGGG + Intronic
1052961569 9:34302235-34302257 ACTTTGGGAGGCCGAGGCCGTGG - Intronic
1055295693 9:74830845-74830867 ACTTTGGGAGGCCGAGGCCGAGG - Intronic
1057706714 9:97399928-97399950 GCCTTGAGAGGCCAGGGCCGGGG - Intergenic
1058679205 9:107426478-107426500 GCTTTGGGAGGCCGAGGCAGGGG + Intergenic
1060477923 9:123999610-123999632 GGGTGGGGAGGCCGGGGACGCGG + Intergenic
1061047474 9:128174374-128174396 GTGCAGGGAGGCTGGGGCTGTGG + Intronic
1061129948 9:128703066-128703088 GCGTCGCGGGGCCGGGGCCAGGG - Intronic
1061233641 9:129329305-129329327 ACTTTGGGAGGCCGAGGCCGAGG + Intergenic
1061261336 9:129482486-129482508 GCGTGGGGGGTCGGGGGCCGCGG + Intergenic
1061293705 9:129666151-129666173 GGGTGGCGGGGCCGGGGCCGGGG + Intronic
1061583958 9:131554708-131554730 GCCCAGCGAGGACGGGGCCGCGG + Intergenic
1061710891 9:132486985-132487007 GCGCAGGCAGCCCCGGGCCGTGG + Intronic
1062022782 9:134327022-134327044 GGCCAGGGAGGCCGGAGCCGCGG - Intronic
1062559598 9:137135347-137135369 ACTTTGGGAGGCCGGGGGCGGGG + Intergenic
1203773689 EBV:61559-61581 GCGGGCGGAGGCCGAGGCCGTGG - Intergenic
1185836193 X:3347196-3347218 GGGGAGGGAGGCGGGCGCCGGGG - Intergenic
1189850190 X:45169954-45169976 GCCTTGGGAGGCCGGCGCGGTGG + Intronic
1189877275 X:45449052-45449074 GCTTTGGGAGGCCGAGGCGGGGG + Intergenic
1190056865 X:47186195-47186217 GGGTCTGGAGCCCGGGGCCGGGG + Intronic
1190265921 X:48827100-48827122 GCGCAGGGAGGCCGCGGCCCTGG - Intergenic
1192175195 X:68880909-68880931 GGGCAGGGAGGGCGGGGCAGGGG - Intergenic
1192360092 X:70433919-70433941 GCGTCCGGAGGCCGGGCGCGCGG + Intergenic
1196015437 X:110934724-110934746 GGGTAGGAATGCCTGGGCCGTGG + Intergenic
1196584036 X:117409068-117409090 GCGTGGGAAGGCTGGGGCCCTGG - Intergenic
1196965217 X:121047766-121047788 GCGTTGCTGGGCCGGGGCCGCGG + Exonic
1197825881 X:130589862-130589884 AAGTAGGGAGGCCAGGGCAGAGG - Intergenic
1199769641 X:150966350-150966372 GGATATGGGGGCCGGGGCCGAGG + Intergenic
1200093873 X:153648220-153648242 GCGCGGGGAGGCCGAGGCCGAGG + Exonic