ID: 1152675376

View in Genome Browser
Species Human (GRCh38)
Location 17:81637411-81637433
Sequence GTAGAGAAACAATTTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152675372_1152675376 3 Left 1152675372 17:81637385-81637407 CCAAACTTCTCTCCATGCACAGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG 0: 1
1: 0
2: 5
3: 30
4: 345
1152675374_1152675376 -9 Left 1152675374 17:81637397-81637419 CCATGCACAGGTAAGTAGAGAAA 0: 1
1: 0
2: 3
3: 17
4: 256
Right 1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG 0: 1
1: 0
2: 5
3: 30
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152675376 Original CRISPR GTAGAGAAACAATTTCAGGA AGG Intronic
902648010 1:17817492-17817514 GCAGAGAAAGTATTTCAAGAAGG - Intronic
903228957 1:21910270-21910292 GGGCAGGAACAATTTCAGGAAGG - Intronic
903560437 1:24223173-24223195 GTACAGAAACAATTCCAGGTTGG + Intergenic
903716781 1:25373797-25373819 GTAGAATAACAAGTTCTGGATGG + Intronic
906215230 1:44034592-44034614 GTAGAGAAACCACAACAGGATGG - Intergenic
906441837 1:45853648-45853670 ACAGAAAAACAATTTTAGGATGG - Intronic
906569287 1:46822526-46822548 GTAGAGAAAAACTATCAGGTGGG + Intergenic
906808209 1:48800915-48800937 GTAGAGAAAAAACATCAGGTTGG + Intronic
906875028 1:49528192-49528214 GTAGAAAAAGCATGTCAGGAAGG + Intronic
908174106 1:61537508-61537530 ATAAACAAACAATTTCTGGAGGG - Intergenic
908364585 1:63406632-63406654 GTAAAGTAACAAATTCAGCAAGG - Intronic
908775410 1:67634641-67634663 GGAGAGAAACTACTTCATGAAGG - Intergenic
908846766 1:68332621-68332643 ATTGAGATACATTTTCAGGAAGG - Intergenic
911065405 1:93783651-93783673 GTAGAAAAACATATTCAGTATGG + Intronic
911097917 1:94070455-94070477 GAAGAAAGACAATTTCAGGCAGG - Intronic
911767859 1:101700968-101700990 GGAGAGGAAGAATATCAGGAAGG - Intergenic
912033096 1:105274552-105274574 GTAGAGAAAGAATCCCAGGTGGG + Intergenic
912484500 1:110014650-110014672 CAAAAGAAACAATTTCAGAAGGG - Intronic
912774638 1:112497796-112497818 GCAGAGAAACGATTTTAAGATGG - Intronic
913247952 1:116886892-116886914 GTGGAGAAAGAATCTAAGGAAGG - Intergenic
913456971 1:119042690-119042712 GTAGAGATTTAATTTCATGACGG - Intronic
914587049 1:149072310-149072332 GGAGAGAGACAAACTCAGGAAGG + Intronic
916022400 1:160804279-160804301 GTTGAGAAATTTTTTCAGGAAGG + Intronic
916488855 1:165283703-165283725 GTAGAGAAACCATGTCTGAATGG + Intronic
917765701 1:178214305-178214327 ATAAATAAATAATTTCAGGAAGG + Intronic
918505316 1:185247309-185247331 GTAAAGGCACAATTTCAGAAGGG + Intronic
918521760 1:185422458-185422480 CTAGAGAAACAATGTTAGAATGG + Intergenic
918589253 1:186222210-186222232 GTAGAGAAAGAACTCCAGGTTGG - Intergenic
921618315 1:217297951-217297973 GTAGAGAAGGAATTGGAGGAAGG + Intergenic
921820418 1:219610486-219610508 GAAGAGAAGAAACTTCAGGAAGG - Intergenic
922559047 1:226554738-226554760 GAAGATAGACAATTTCAGCATGG - Intronic
923233738 1:232012557-232012579 GTAGAGAAACCAGTATAGGATGG - Intronic
1062804387 10:406420-406442 GTAGAGAAACAAAAGCAGAAAGG - Intronic
1063511070 10:6646073-6646095 GTAGAAAAACACTTTCAGGCCGG + Intergenic
1064652551 10:17523955-17523977 GAAGAAAAACTATTTCAGGCAGG - Intergenic
1064829899 10:19451125-19451147 GTTGAAAAACAAATTCAGAAGGG - Intronic
1065012918 10:21435756-21435778 GTGGAAAGAAAATTTCAGGATGG + Intergenic
1065562160 10:26974660-26974682 CTAAAGAATCTATTTCAGGAAGG - Intergenic
1067562800 10:47315537-47315559 GCAGAAAAACAAGCTCAGGAAGG + Intergenic
1068808555 10:61228250-61228272 GTAGAGAAACACCATCAGGTTGG - Intergenic
1069941596 10:71959759-71959781 GTACAGAAACAATTACAAAAGGG + Intergenic
1070348130 10:75565387-75565409 CAAGAGCAACAATTTCAGGTAGG - Intronic
1071867445 10:89750745-89750767 GGCCAGAAACAATTTTAGGAAGG + Intronic
1072098879 10:92209971-92209993 TTCAAGGAACAATTTCAGGAAGG + Intronic
1072284662 10:93902339-93902361 GAAGAGAAAACACTTCAGGATGG - Exonic
1072354553 10:94594473-94594495 CTAAAGAAAACATTTCAGGATGG - Intronic
1073393613 10:103199971-103199993 GTAGAGAAACAGTTTAACGTAGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1078987382 11:16608868-16608890 TTGGAGAAACAATTTCAAGAGGG + Intronic
1079480929 11:20879098-20879120 GTACACACACAACTTCAGGATGG + Intronic
1079806064 11:24932401-24932423 GTAGAGAAAGACCTTCAGGTCGG + Intronic
1080149168 11:29027728-29027750 GTAGAGAAATAGTTTCATGCTGG + Intergenic
1080957087 11:37110766-37110788 GTGGAGAAATAATTTCAGGAGGG + Intergenic
1082053506 11:47793283-47793305 CTAGAGAAACAAATTTTGGAAGG - Intronic
1082869572 11:57931590-57931612 GTAGAGAAATGATTGGAGGAGGG + Intergenic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084140340 11:67223804-67223826 GTATAGCAACACTTTCTGGAAGG - Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1086841496 11:91690290-91690312 GAAAAGAAACCATATCAGGAAGG + Intergenic
1086982991 11:93219054-93219076 ACAGAAAAACAATTTCAGCAGGG + Intergenic
1087351131 11:97033905-97033927 GTAGATAAACAATATCTGAAAGG - Intergenic
1087891996 11:103545903-103545925 GTAGGGAAAGAAATTCATGATGG - Intergenic
1088510328 11:110566848-110566870 GTAGAGAAATAAAACCAGGAAGG - Intergenic
1088859241 11:113784412-113784434 TTAGAGAAAGAGTTTGAGGAAGG + Intergenic
1089789901 11:120934957-120934979 TTAGGGAAAGAAATTCAGGAAGG - Intronic
1090432211 11:126655520-126655542 GAAGAGAAACAACTTGAGGTGGG - Intronic
1093164950 12:15793318-15793340 GTAGACAAGTAATTTCAGGTTGG + Intronic
1093915445 12:24797253-24797275 GCAGAGAAAGAATTTCAACATGG + Intergenic
1094073415 12:26445555-26445577 GTGAAGAAATAATTTCAAGAAGG + Intronic
1095909746 12:47414216-47414238 CTTCAGGAACAATTTCAGGAAGG + Intergenic
1098426612 12:70371440-70371462 GTTCAGAAACAATTCCAGGCAGG - Intronic
1098775815 12:74614378-74614400 GCAGAGAAAAATTTTCATGACGG + Intergenic
1099006322 12:77238567-77238589 GAATAGAAACAATTCAAGGACGG - Intergenic
1099479295 12:83145972-83145994 GTAGTGAAAGAATATCAGGATGG - Intergenic
1099661491 12:85568662-85568684 GGGGAGAGACAATTTCAGGCAGG + Intergenic
1099843525 12:87998160-87998182 CTACAGAAAGAAATTCAGGAAGG - Exonic
1099944476 12:89228151-89228173 GAAGTGAATCAATCTCAGGAAGG - Intergenic
1101452957 12:104797291-104797313 GTAAAGAAAATATTTCAAGATGG + Intergenic
1102362438 12:112299973-112299995 GTTGAAAAACAATTTCTGGCAGG + Intronic
1103671230 12:122617543-122617565 CAAGAGAAAGAATTTCAAGAAGG - Intronic
1104059997 12:125259608-125259630 TTACAGAAACCATTTAAGGAGGG - Intronic
1105587616 13:21759462-21759484 TTACTGAAATAATTTCAGGATGG - Intergenic
1106034778 13:26033724-26033746 GTACAAAAAGAATTTCACGAAGG - Intergenic
1106799025 13:33236950-33236972 GGGAAGAAAGAATTTCAGGAAGG - Intronic
1106813617 13:33383853-33383875 GTAGAAAAACAAACTCACGAAGG - Intergenic
1108131918 13:47310630-47310652 GTAGAGAAAAACTATCAGGTGGG - Intergenic
1108901139 13:55410310-55410332 GTACAGAAAAACTTTCAGGTGGG + Intergenic
1109835981 13:67857939-67857961 GTAGAGAAATAGTATCAGGTGGG - Intergenic
1110158040 13:72342282-72342304 GTAGAGAAAGATTGTCAGGTGGG + Intergenic
1110205390 13:72906130-72906152 ATAGAGAAATAATTTCATCATGG + Intronic
1114760488 14:25308590-25308612 GTAGAGAAAAACTATCAGGTGGG - Intergenic
1115315254 14:32018622-32018644 CTAGAGAAACAATAGGAGGAGGG - Exonic
1115353200 14:32419138-32419160 TCAAAGAAACAATTTCAGCAAGG - Intronic
1116069493 14:40025865-40025887 GTAAAGCTACAATTACAGGAGGG - Intergenic
1116460237 14:45164359-45164381 GTAGTGAAACAGTTTCGTGACGG + Exonic
1118623591 14:67636373-67636395 GCAGAGGAAGAATTTCAGCAAGG - Intronic
1119547583 14:75483379-75483401 GAAGAGAAATAATTTAAAGATGG - Intergenic
1119589046 14:75867774-75867796 GCAAAAAAAAAATTTCAGGATGG + Intronic
1125268544 15:37912878-37912900 AAAGAGAAACTATTTCATGAGGG + Intergenic
1125747400 15:42006271-42006293 GTAGGGAAACGAATTAAGGAAGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126475304 15:49059602-49059624 GTACACAAATAATTTCAGGCAGG - Intergenic
1126510770 15:49471113-49471135 GTAGAAAAACTAATTCAGAAAGG + Intronic
1128859382 15:71053087-71053109 GTAGAGAATCAACTTCAGGAGGG + Intronic
1130650366 15:85759075-85759097 GGAGAGAATCACTCTCAGGAGGG + Intergenic
1130826455 15:87551803-87551825 GTTGAAAATCAATTTCAGTAGGG - Intergenic
1133107364 16:3521127-3521149 GTAAAGAGCCAGTTTCAGGAGGG - Intronic
1133382349 16:5341782-5341804 GAAGAGAAACACTTTATGGAAGG + Intergenic
1137694334 16:50451238-50451260 AGAGAGAAACATTTGCAGGAGGG - Intergenic
1138596865 16:58033717-58033739 GTAGAGACACAGTTTCACTATGG - Intronic
1138772156 16:59678641-59678663 GCACAGAAACAATTCCAAGAAGG - Intergenic
1139029438 16:62861181-62861203 TTAGAGATATAAGTTCAGGAGGG - Intergenic
1139193917 16:64896505-64896527 TTTAAGAAACAGTTTCAGGATGG + Intergenic
1141968951 16:87466913-87466935 GTAAAGAAACAAGGTGAGGAGGG - Intronic
1142889765 17:2935599-2935621 TTATAGAATTAATTTCAGGATGG - Intronic
1143528881 17:7489051-7489073 CTAGAGAATGAATTTCATGAGGG + Intronic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1143743305 17:8970649-8970671 GTAGAAAAACAAGTATAGGAAGG + Intergenic
1144470198 17:15532718-15532740 ATAGAGAAACATTTCCAGAATGG - Intronic
1144926142 17:18810928-18810950 GTAGAGAAACATTTCCAGAATGG + Intergenic
1146557211 17:33836294-33836316 GTAGAGACAGAATTTCACCATGG + Intronic
1146639409 17:34528631-34528653 GTACAGAAGGAGTTTCAGGAAGG - Intergenic
1146723681 17:35140884-35140906 GCAGATAAAGAATTTCAGGCCGG - Intronic
1146987985 17:37240475-37240497 GTAGAGACACAATTCCAGAATGG - Exonic
1150929961 17:69573670-69573692 GAAGAAAAATAACTTCAGGATGG - Intergenic
1151492644 17:74441917-74441939 ATAGAAAAACAAGTTCTGGAAGG - Intronic
1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG + Intronic
1153602038 18:6790133-6790155 TTAAAGAAACAATTTGAGGCAGG - Intronic
1153887486 18:9479492-9479514 GTAGAGTAAGGATTTCAGAAGGG + Intronic
1154357151 18:13630372-13630394 GTAGTGATAAAATATCAGGATGG + Intronic
1155226450 18:23733601-23733623 ATAGCCAAACCATTTCAGGAAGG + Intronic
1155946445 18:31857652-31857674 GTAGAAGAACAGTGTCAGGAAGG + Exonic
1156345226 18:36251176-36251198 GTGGAGAAAAAATTTCAAGCTGG + Exonic
1156642535 18:39119711-39119733 GTAGAGAAAGACTATCAGGTGGG - Intergenic
1157181813 18:45505137-45505159 GGAAAGAAACAATTTTATGAGGG + Intronic
1157653732 18:49363954-49363976 GAAAAGAAAGAATTTCATGAAGG - Intronic
1157866776 18:51194873-51194895 GTGGAGGAACAATGTGAGGAGGG - Intronic
1158138772 18:54234370-54234392 GGAGAGAAAGAATTTCAAGATGG - Intergenic
1158543661 18:58378356-58378378 GTAGAGAAACACTTGGGGGAAGG + Intronic
1158856294 18:61545823-61545845 TTAGAGAAATACTTTCAGGTAGG + Intronic
1159710947 18:71758834-71758856 ATAGGGAAACAATATAAGGAGGG - Intronic
1159930098 18:74302669-74302691 GTAGAGAAAAACTTTCTGCAGGG - Intergenic
1160597982 18:79990260-79990282 GTAATGAAACAATTTCAGGTTGG + Intronic
1162200732 19:9018262-9018284 GTAAAGAAGCTATTTCGGGAAGG - Intergenic
1164679966 19:30127568-30127590 GTAGAGATACAATTTCACTATGG - Intergenic
1165576430 19:36823459-36823481 GAAGAGAAACAATTACAGGCAGG + Intronic
1166128173 19:40729074-40729096 GGAGAGAAAGCATTGCAGGAGGG + Intronic
1167686403 19:50959600-50959622 AAAGAGAAACAATTTAAGAATGG + Intronic
1167891148 19:52540387-52540409 ATAGAGAAACAATTTTAAAATGG - Intronic
1167912810 19:52717965-52717987 ATAGAGAAACAATTTTAAAATGG + Intronic
1168458679 19:56536472-56536494 GTAGGGAAAGAATTTAAGTAGGG - Intergenic
925064140 2:916037-916059 GTAGAGAAACAAATTCAGTGCGG + Intergenic
925072851 2:984635-984657 GTGAAGGAGCAATTTCAGGACGG - Intronic
928427417 2:31190733-31190755 GTAGAGAAACCATTTTACGCAGG - Intronic
929732241 2:44508411-44508433 GTATAGAACCAGTTACAGGAAGG + Intronic
930035125 2:47080431-47080453 GGAGAGAAACAAGTGAAGGAAGG - Intronic
931369927 2:61652833-61652855 GGAGATAAACAATTTTAGGCTGG + Intergenic
931481116 2:62641418-62641440 TTAGGGAAACAAATTCAGCAGGG + Intergenic
931923995 2:67051280-67051302 GTAGAAAATGAATTTGAGGAAGG + Intergenic
933110762 2:78397297-78397319 GTAGAGAAAGACTATCAGGTGGG - Intergenic
933840267 2:86280890-86280912 GTAAAGAAACAATTCAAGGTGGG - Intronic
935050720 2:99522863-99522885 GAAGAGAAATAATTTCTGGCTGG + Intergenic
935619445 2:105116181-105116203 GTATACATACAATTTTAGGACGG + Intergenic
936714102 2:115163599-115163621 ATAGAAAAATAATTTCAGAACGG + Intronic
937413612 2:121697320-121697342 GGAGAGAAAGAAATTCAGGTAGG + Intergenic
938851371 2:135264174-135264196 TTAGAAAAACCATTTCAGGCCGG + Intronic
939277398 2:140016442-140016464 GTAGAGAAAGAAAATCAGTATGG - Intergenic
939374468 2:141345896-141345918 GTAGAGAAAACAATTCAAGAAGG - Intronic
940033089 2:149285649-149285671 GTAGAGAATGGATTTGAGGAAGG - Intergenic
940611316 2:155995443-155995465 TTAGAGACACACTTTCATGAAGG + Intergenic
940805964 2:158186791-158186813 CTAGAAAAAAAATTTCAGGAGGG - Intronic
942086014 2:172444689-172444711 GTAGAGAAAGAAACTCAGGGGGG - Intronic
943434407 2:187846735-187846757 GAAGAGAAATAATTACAAGATGG - Intergenic
943549031 2:189315710-189315732 GCTGATAAACAACTTCAGGAAGG + Intergenic
944500479 2:200354310-200354332 GTAAAGAATCAAGTTCAGGTCGG + Intronic
947147407 2:227080905-227080927 ATAGAAAAATAATTTCAGAAAGG - Intronic
947407708 2:229797813-229797835 GTAGAGAAAAAATTAAAGGTTGG - Exonic
1169157211 20:3341738-3341760 GTAGAGAATCCATTATAGGAGGG - Intronic
1169486154 20:6034814-6034836 GAAGAGGGACAGTTTCAGGAAGG + Intronic
1169947135 20:11001211-11001233 GGAGAGGAAAAGTTTCAGGAAGG - Intergenic
1169968400 20:11242588-11242610 GCAGAGAAAGGATTTCATGAAGG - Intergenic
1170318979 20:15073559-15073581 TTAGAGAAATCACTTCAGGATGG + Intronic
1170764623 20:19279505-19279527 GCAGAAAGAGAATTTCAGGAAGG - Intronic
1171099127 20:22365960-22365982 GTATAGAAAAAATAACAGGAAGG - Intergenic
1171986648 20:31665602-31665624 GCAGAAAAACATTTTCAGGGAGG + Exonic
1172359015 20:34299370-34299392 GTAAAGAAAGGGTTTCAGGAAGG - Intronic
1173373097 20:42457807-42457829 GTAAAGAAACAATTACAGGAAGG - Intronic
1175212084 20:57366010-57366032 GTGCTGAAACATTTTCAGGAAGG + Intronic
1177646745 21:23908589-23908611 TTAGAGAGATAATTTCAAGAAGG + Intergenic
1177702601 21:24657852-24657874 GGAGAGAATCAGTTTTAGGAAGG - Intergenic
1178057644 21:28817292-28817314 CTTGAGAAACTATTTCAGAAAGG - Intergenic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1179483280 21:41692205-41692227 GCAGAGAAACAATTTGGAGAAGG - Intergenic
1179568356 21:42263128-42263150 GTCTAGAAGGAATTTCAGGAAGG - Intronic
1184065516 22:42117265-42117287 GTAGAGAAATACTGTCAGGTTGG + Intergenic
949343885 3:3058704-3058726 GTGGAGAAGGCATTTCAGGAAGG - Intergenic
950358359 3:12430744-12430766 GTTGAGGAAGGATTTCAGGATGG + Intronic
951122792 3:18948044-18948066 GAAAAAAAAAAATTTCAGGATGG - Intergenic
951378903 3:21958109-21958131 GGAGATAAAAAATTTCAGGGAGG - Intronic
951911718 3:27757195-27757217 GATTAGAAACAAGTTCAGGATGG + Intergenic
952122715 3:30263948-30263970 GTAGAGAAAGAACATCAGGTGGG - Intergenic
952435537 3:33269427-33269449 GTAGAGAAAAAACATCAGGTGGG + Intergenic
956437589 3:69248612-69248634 GTAGAGAAACAGTTAAAGGGTGG - Intronic
956459053 3:69453623-69453645 GTAGAAAACCAATCTCAGCATGG + Intronic
956821345 3:72957110-72957132 GGAGGGAAACAAATACAGGAGGG - Intronic
956886842 3:73568966-73568988 GCAGAACAACAATTTCAGCAAGG - Intronic
957204948 3:77184600-77184622 GAAGAGAGAAAATTTCAGGATGG + Intronic
958785965 3:98596573-98596595 GTATAGATACCATTTCAGGGAGG + Intergenic
959673559 3:109007730-109007752 GAAGAGAAACAATGCCATGACGG - Intronic
960851835 3:122063739-122063761 GTAGAGACACAGTTTCATCATGG + Intronic
962069906 3:132022511-132022533 GGAGAGAAGCACTTGCAGGAAGG - Intronic
962414920 3:135173328-135173350 TTAAAGAAACTATTTCAGGCCGG - Intronic
962698617 3:137975296-137975318 GTAGAGAAATACTTTCATCATGG - Intergenic
963545328 3:146650399-146650421 GAAGAGAAACAATTTAAGGATGG - Intergenic
963558009 3:146820329-146820351 ATAGAGAAGCAATTCCATGAAGG + Intergenic
964211201 3:154230156-154230178 GTAAGGAAACAAATACAGGAAGG - Intronic
966209003 3:177433558-177433580 CTAGAGAAATAATTTGAGGTTGG - Intergenic
966283374 3:178262772-178262794 TGACAGAAACAATTTCAGAAGGG - Intergenic
966657676 3:182377803-182377825 TTATAACAACAATTTCAGGAGGG - Intergenic
967087210 3:186106840-186106862 ATAAAGTAACAATTTCAGGGAGG + Intronic
967105031 3:186248809-186248831 GTACAGAAACAAGTTCAGGCTGG - Intronic
969500887 4:7552304-7552326 GAAGAGAAAGAATCCCAGGAAGG + Intronic
970147705 4:13054182-13054204 ATAGAGAAACAAAATCTGGAGGG - Intergenic
970265599 4:14280686-14280708 GTGAAGAAAATATTTCAGGAAGG + Intergenic
971548674 4:27920857-27920879 GTATACAAACAACTTCAGCATGG - Intergenic
971576409 4:28280539-28280561 GTAGAGAAAGACCTTCAGGTTGG - Intergenic
971867443 4:32190673-32190695 CTAGAGAAAGAATTTCTGAATGG - Intergenic
972037227 4:34540761-34540783 ACAGAGAAAAAATTTCAGGAGGG + Intergenic
973170666 4:47139065-47139087 GTAGAGAAACAAGGTCCAGAAGG - Intronic
975337201 4:73192438-73192460 GTACACAAAAAATTTCAAGATGG + Intronic
975713691 4:77185782-77185804 TTAGAGATACAATTGAAGGAGGG + Intronic
977214025 4:94257581-94257603 GTAAATAAACAATTTGGGGATGG - Intronic
977637729 4:99319185-99319207 GTAGACGAGCATTTTCAGGACGG - Intronic
978165491 4:105602047-105602069 GTGGATGAACAACTTCAGGATGG + Intronic
979106522 4:116695908-116695930 GTAGAAAAACAATTTGTGGCCGG - Intergenic
979215575 4:118160043-118160065 GTAGAGATCCAAGTTCAAGAAGG + Intronic
981052429 4:140322678-140322700 AGAGAGAAACAATTTAAAGATGG + Intronic
981155859 4:141434008-141434030 CTAAAGAAAAAATTTTAGGAGGG - Intergenic
983430358 4:167642339-167642361 GAATTGAAATAATTTCAGGAAGG - Intergenic
983687104 4:170423335-170423357 GGACAGAAACATTTTTAGGAGGG + Intergenic
983690351 4:170462289-170462311 GCTGATAAACAATTTCAGTAAGG - Intergenic
984010333 4:174363525-174363547 GTACAGAAACAATTCCAGGGAGG + Intergenic
984293808 4:177828760-177828782 GAAGTAAAATAATTTCAGGAGGG + Intronic
985086975 4:186323884-186323906 TTAGATAAACAGTTGCAGGAGGG + Intergenic
987659940 5:20859345-20859367 ACAGAGAAACGATTTCAAGAGGG - Intergenic
988763703 5:34346309-34346331 ACAGAGAAACGATTTCAAGAGGG + Intergenic
989530258 5:42499671-42499693 TTAGGGAATCAAGTTCAGGAGGG + Intronic
990660204 5:58005398-58005420 GTAAACAAACAATTTGATGAGGG - Intergenic
990836208 5:60023261-60023283 GTAGAGAAAGAATTTAAGGAGGG - Intronic
991065268 5:62417834-62417856 GGAGGAAAACAATGTCAGGAAGG - Intronic
992070753 5:73146513-73146535 GCAGAGAAAGAATTCCAGGTTGG + Intergenic
992295291 5:75321507-75321529 TTAAAGAAACCATTTCAGGTAGG + Intergenic
993153275 5:84188442-84188464 GGAGAGAAACAATTAGAAGAAGG - Intronic
993339123 5:86700826-86700848 GTAGAGTAACAATTTTTTGAAGG + Intergenic
994083358 5:95731699-95731721 GGAGAGAGACAATGGCAGGACGG - Intronic
994208214 5:97059712-97059734 GTAGAGAAAAAATATCAGGTTGG + Intergenic
997232673 5:132255877-132255899 GTAATGAAGGAATTTCAGGATGG + Intronic
998297989 5:140989979-140990001 GGAGATAGACAATTTCAGGCAGG - Intronic
999220569 5:149973428-149973450 AGAGAGAGACAGTTTCAGGAAGG - Intronic
999595938 5:153204765-153204787 GCAGAGAACCAATTTGAGGAAGG - Intergenic
999656545 5:153816152-153816174 GTAGAGAAACAATAGCGGGAAGG + Intergenic
1000655079 5:163867831-163867853 TTAGAAAAACATTTTAAGGAAGG - Intergenic
1002307577 5:178292892-178292914 GTAGAGAAAGTGTCTCAGGAGGG + Intronic
1002667896 5:180840037-180840059 CTAAAGAAAGAATGTCAGGAAGG + Intergenic
1002993956 6:2265254-2265276 GAAGGAAAAGAATTTCAGGATGG + Intergenic
1003797111 6:9616837-9616859 GCAGAAAAACAAGTTAAGGACGG + Intronic
1004305669 6:14499878-14499900 ATAGAGAGACAATAACAGGAGGG + Intergenic
1004549764 6:16635713-16635735 GCAGAGAAATAATTTCAAAAGGG + Intronic
1006252767 6:32803513-32803535 GTTGATAAACAACTTCAGCAAGG - Intergenic
1006351175 6:33522047-33522069 GATGATAAAGAATTTCAGGAAGG - Intergenic
1007001829 6:38320619-38320641 GTAGAGAAACAGTCACAGAATGG - Intronic
1007122034 6:39390356-39390378 GTAGAGATACATTTAGAGGAGGG + Intronic
1009565220 6:65304076-65304098 GAAGAGAAGAAACTTCAGGAAGG + Intronic
1009988334 6:70809136-70809158 GTAGAATAAAAATTCCAGGAAGG + Intronic
1010308290 6:74350421-74350443 GAAGAGAAACAATTTTACCAAGG + Intergenic
1010609232 6:77932843-77932865 GGAAAGAAACTATTTCAGTATGG - Intergenic
1011052459 6:83168129-83168151 GTAGAAAAAGATTTTCTGGAAGG + Exonic
1011056875 6:83214493-83214515 GGAAAGAGACAATTTCAGAATGG - Intronic
1011609537 6:89137225-89137247 TTATAGAAAGAATTTCAGGCTGG + Intergenic
1011778134 6:90755171-90755193 GTATAGAAACAGTTTCACTACGG + Intergenic
1012046425 6:94280916-94280938 TTAGAGAAACAATAAAAGGATGG - Intergenic
1013832414 6:114290437-114290459 TTATAGACAAAATTTCAGGATGG - Intronic
1014031131 6:116706391-116706413 TTATAAAAACAATTTCAGGCTGG + Intronic
1014245149 6:119060200-119060222 GGAGGGAAAGAATTACAGGAAGG - Intronic
1014278596 6:119416561-119416583 GTAGAGAAAAAACATCAGGTGGG + Intergenic
1014445240 6:121519196-121519218 GTAGAAAAATAATTTCTGGCTGG - Intergenic
1014793245 6:125699255-125699277 GAATACACACAATTTCAGGATGG + Intergenic
1014816974 6:125946671-125946693 GTAAAGAAAGAGTTTCAGGAGGG - Intergenic
1014961469 6:127691470-127691492 TTAGAGAAATAATTTCAGAAAGG + Intergenic
1015205451 6:130633012-130633034 GAAGAGAAACGACTCCAGGAGGG + Intergenic
1015651416 6:135465149-135465171 CTAGAGAAACAACTTGAGGTGGG - Intronic
1016351743 6:143176447-143176469 GTAGAGAAAGACTATCAGGCTGG + Intronic
1016508141 6:144808172-144808194 ATAGAGAGAAAATTTCATGAAGG + Intronic
1016641609 6:146355790-146355812 AGAGAGAAAGAATTGCAGGAAGG + Intronic
1017311269 6:152980564-152980586 GTGGAGAATGAATTGCAGGAAGG + Intronic
1017644625 6:156527526-156527548 GCAGAGAGACAAATCCAGGAGGG + Intergenic
1018775439 6:167010433-167010455 GTAGGGAAACAAATTCAAGGAGG + Intronic
1019109564 6:169698995-169699017 GCACAGAAACAAATTCAGGAGGG + Intronic
1019226962 6:170520616-170520638 ATTGATAAACAATTTCAGTAAGG + Intergenic
1019583927 7:1785883-1785905 GGAGAGAAGCACTGTCAGGAGGG - Intergenic
1020508601 7:9023361-9023383 GTTGAGAAGCATTTTCAGAATGG - Intergenic
1020512182 7:9070953-9070975 GTAGAGAAACTAATCAAGGAAGG - Intergenic
1021577813 7:22120443-22120465 ACACAGAAACAATGTCAGGATGG + Exonic
1024230667 7:47361043-47361065 GCAGAGGAAGAATCTCAGGAGGG - Intronic
1024819379 7:53309536-53309558 GTAGAGAAACAAACTCAGAGTGG - Intergenic
1024987362 7:55206983-55207005 GTAGAGAAATTATTTTAGGAAGG - Exonic
1025077321 7:55954142-55954164 GTGGAAAAAATATTTCAGGAAGG + Intronic
1025753494 7:64313030-64313052 GTTGAGAAACAGTCTCAGGGAGG - Intronic
1026104136 7:67407740-67407762 TTAGAGAAAGAGCTTCAGGAAGG - Intergenic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1028642557 7:93059280-93059302 GTGGAGAAAATATTTCAGGAAGG + Intergenic
1029885613 7:103867709-103867731 GGAGAGATTAAATTTCAGGATGG - Intronic
1029921886 7:104273935-104273957 GTAGGAAAATAATTTCTGGAGGG - Intergenic
1030619600 7:111774581-111774603 GAAGAAAAAGAACTTCAGGAGGG + Intronic
1030885513 7:114931712-114931734 GTTGAGAGAGGATTTCAGGATGG + Intronic
1031451467 7:121926006-121926028 GTAGAGAAAGAATTACAAGCCGG + Intronic
1031576675 7:123422835-123422857 GTAGAGAAAGAACATCAGGTTGG - Intergenic
1031631702 7:124050869-124050891 GTAGAGAAAAAACTCCAAGAGGG - Intergenic
1031696343 7:124860275-124860297 GTTGAGATAGAATTTCATGATGG - Intronic
1031867818 7:127058583-127058605 GAAGGAAAACAATTTGAGGAAGG - Intronic
1032019104 7:128396713-128396735 GCAGAGGAACAATGTGAGGATGG + Intronic
1033401247 7:141027213-141027235 GTAGAGAAAAACCATCAGGAGGG + Intergenic
1033917588 7:146346777-146346799 GTAGGGTAAATATTTCAGGATGG - Intronic
1034051471 7:147988675-147988697 AGAGAGTAACAAGTTCAGGAAGG - Intronic
1038178514 8:25203911-25203933 GTTGAGGAGCAATTTTAGGAAGG - Intronic
1038713277 8:29969229-29969251 GTAGAGGACAAATTTAAGGAGGG - Intergenic
1038716949 8:29999669-29999691 GCAGAGAAAAAATGTCTGGAGGG - Intergenic
1039180683 8:34862555-34862577 GAATAGAAACAATTCCAGAATGG + Intergenic
1040671055 8:49691276-49691298 GTAGAGAAACACCATCAGGTGGG + Intergenic
1040824921 8:51610503-51610525 ATAGAGAAACTATTTTAGGGAGG + Intronic
1040982226 8:53255585-53255607 GAGAAGAAAGAATTTCAGGATGG + Intergenic
1041771192 8:61474213-61474235 GAACAGAAAGGATTTCAGGAAGG + Intronic
1041868174 8:62600622-62600644 ATAGAGAAACAAATGCAGGTGGG - Intronic
1042438492 8:68796345-68796367 GTAGAGAAACACTTGCAGAAAGG - Intronic
1043821827 8:84875936-84875958 GCAGAGAAATAATGGCAGGAAGG + Intronic
1044636178 8:94326792-94326814 GAAGGGAAAAAATATCAGGAGGG + Intergenic
1044747545 8:95385359-95385381 GCAGACACACAATTTGAGGAGGG - Intergenic
1045180111 8:99771720-99771742 GGAGAGAAACAATATCTGGAAGG - Intronic
1045701135 8:104867556-104867578 GTAGAGACAAACTTTCAGCATGG - Intronic
1046413622 8:113881678-113881700 GTAAAGAGACAATTACAGAATGG + Intergenic
1046725359 8:117667897-117667919 GTAAAGAAACAATATCAGCCAGG + Intergenic
1047215368 8:122871867-122871889 GCACAGAAACAAGCTCAGGAAGG + Intronic
1047410338 8:124619434-124619456 GTAAAGAGACAATGGCAGGACGG - Intronic
1047842388 8:128767095-128767117 GTAGAGAAATACTATCAGGTGGG - Intergenic
1047945040 8:129868179-129868201 GTAGAGAAACAAATTAAGAAAGG - Intronic
1047975305 8:130123957-130123979 GTAGAAAAACAATTATAGAATGG + Intronic
1050739804 9:8806602-8806624 ATATAGAATTAATTTCAGGAAGG - Intronic
1050832624 9:10032460-10032482 GGAGTGAAAGAATTTCAGGGAGG - Intronic
1050891198 9:10826651-10826673 GCTGAGAAACAACTTCAGCAAGG - Intergenic
1052531505 9:29690595-29690617 GTAGAAATAAAATATCAGGAAGG + Intergenic
1055797445 9:79990236-79990258 TTTGAGAAATAATTTCTGGAAGG - Intergenic
1055966769 9:81873047-81873069 GTAAAGAAAGGAGTTCAGGACGG - Intergenic
1056770918 9:89477684-89477706 GCAGAGAAAAAAATTCAGAAAGG + Intronic
1057936053 9:99239779-99239801 GTAGAGGAATGATTTCAGGCTGG + Intergenic
1059037937 9:110779268-110779290 ATTGAGAAATAAATTCAGGAGGG - Intronic
1059575139 9:115479579-115479601 TCTGAGAAAGAATTTCAGGATGG + Intergenic
1059857047 9:118411099-118411121 GTAGGGATAAAATTTCATGAGGG + Intergenic
1186209882 X:7239207-7239229 GTTTAGACACAATTTCAGAATGG + Intronic
1186590367 X:10924405-10924427 GCAGACAAGAAATTTCAGGAAGG + Intergenic
1186786139 X:12957373-12957395 GTAGAGAGACCATTTCCGGAAGG - Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189735208 X:44063081-44063103 GTAGAGAAAGAATGGAAGGAAGG + Intergenic
1191741743 X:64443470-64443492 GTAGATAAAGAATTCCTGGATGG + Intergenic
1192688669 X:73335052-73335074 GTAGAGAAAGATTATCAGGTGGG + Intergenic
1193290041 X:79762152-79762174 GTAGAGAAATAACATCAGGTGGG + Intergenic
1193556528 X:82960688-82960710 GTAGAGAAATACTATCAGGCTGG - Intergenic
1194532833 X:95072095-95072117 GTAGAGAAACATCATCAGGTGGG - Intergenic
1195838158 X:109143190-109143212 GTAGAGAAAGACTATCAGGTTGG - Intergenic
1196526062 X:116728096-116728118 GGAGAGAGGCAATTTCATGATGG + Intergenic
1196749123 X:119098691-119098713 GGAGAAAAACAATGTAAGGAAGG - Intronic
1196971198 X:121110203-121110225 GTAGAGAAAGACTATCAGGTGGG - Intergenic
1196978725 X:121188060-121188082 GCAGAGAAGAAATTTCAGAATGG + Intergenic
1197463431 X:126771711-126771733 GTAGAGAAAGACCATCAGGAGGG - Intergenic
1197472192 X:126877627-126877649 GTAGAGAAATACTATCAGGTAGG + Intergenic
1197603744 X:128560667-128560689 GTAGAGAAATACTATCAGGTCGG - Intergenic
1197615774 X:128689945-128689967 GCACAAAAATAATTTCAGGATGG + Intergenic
1198247565 X:134845227-134845249 ATAGAGAAACAATGTCTGAATGG + Exonic
1199710712 X:150467214-150467236 GAAGAGACACAATTTCAGTTTGG + Intronic
1200699317 Y:6388764-6388786 TTACAGAAACAATTTCAGCCAGG + Intergenic
1201034794 Y:9775934-9775956 TTACAGAAACAATTTCAGCCAGG - Intergenic
1202126889 Y:21576338-21576360 TTACACAAACAATTTCAGGCTGG + Intergenic