ID: 1152676523

View in Genome Browser
Species Human (GRCh38)
Location 17:81644290-81644312
Sequence CAGCCTCCAGGCGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 273}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152676518_1152676523 -8 Left 1152676518 17:81644275-81644297 CCTCTGAAGGCCCTGCAGCCTCC 0: 1
1: 0
2: 7
3: 68
4: 454
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273
1152676517_1152676523 -7 Left 1152676517 17:81644274-81644296 CCCTCTGAAGGCCCTGCAGCCTC 0: 1
1: 0
2: 3
3: 31
4: 391
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273
1152676515_1152676523 3 Left 1152676515 17:81644264-81644286 CCAGGGGGTCCCCTCTGAAGGCC 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273
1152676504_1152676523 28 Left 1152676504 17:81644239-81644261 CCAGCAAGCCTTTCCTGCCAGTG 0: 1
1: 0
2: 3
3: 19
4: 245
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273
1152676512_1152676523 15 Left 1152676512 17:81644252-81644274 CCTGCCAGTGGGCCAGGGGGTCC 0: 1
1: 0
2: 0
3: 25
4: 193
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273
1152676508_1152676523 20 Left 1152676508 17:81644247-81644269 CCTTTCCTGCCAGTGGGCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 271
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273
1152676513_1152676523 11 Left 1152676513 17:81644256-81644278 CCAGTGGGCCAGGGGGTCCCCTC 0: 1
1: 0
2: 0
3: 25
4: 273
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273
1152676516_1152676523 -6 Left 1152676516 17:81644273-81644295 CCCCTCTGAAGGCCCTGCAGCCT 0: 1
1: 0
2: 2
3: 24
4: 342
Right 1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG 0: 1
1: 0
2: 2
3: 33
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152676523 Original CRISPR CAGCCTCCAGGCGGTCTTCC TGG Intronic
900096542 1:942274-942296 GAGCCTCCACGCGGGCTCCCAGG - Intronic
900527791 1:3137566-3137588 CCTCCTCCAGGCGGTCCTCCTGG - Intronic
900953805 1:5874696-5874718 CAGCCTCCTGTGGGTCCTCCTGG - Intronic
901057873 1:6457209-6457231 CCGCCTCCAGGCGGGCATGCTGG - Exonic
902410861 1:16210765-16210787 CCTCCTCCAGGAAGTCTTCCTGG - Intronic
902559957 1:17271111-17271133 CAGCTTGCAGCCGGCCTTCCTGG - Exonic
902698309 1:18155059-18155081 CTTCCTCCAGGCAGCCTTCCAGG + Intronic
902779806 1:18697734-18697756 CAGAATCCAGGAGGACTTCCTGG - Intronic
903461878 1:23526020-23526042 CCCCCTCCAGGAAGTCTTCCTGG + Intronic
903550918 1:24156987-24157009 CAGCCGCTAGGTGGACTTCCCGG + Exonic
905336773 1:37249958-37249980 CAGCTTCCAGGATGACTTCCTGG - Intergenic
905428278 1:37901712-37901734 CAGCCACAGGGCGGTCTTCTCGG + Intronic
905921073 1:41719143-41719165 CCTCCTCCAGGAAGTCTTCCAGG - Intronic
906313980 1:44774472-44774494 CAGCCTCCAGACGGAGTTGCTGG + Intergenic
906556676 1:46719279-46719301 CCGCCCCCAGGAGGGCTTCCGGG + Intergenic
907405626 1:54251841-54251863 CAGCCTCCGGGAGGAGTTCCTGG - Exonic
907475272 1:54701226-54701248 CAACCTCAAGGCTGTCTTCAAGG + Exonic
911543399 1:99185918-99185940 CAGCTTCCAGGCTGTCTTTCAGG + Intergenic
913451590 1:118996503-118996525 CTGCCTCCAGGTTGCCTTCCTGG - Intergenic
914918508 1:151832465-151832487 CTGCCTCCAGGCACTCCTCCAGG - Intergenic
915601518 1:156925523-156925545 CCTCCTCCAGGCAGTCTTCCAGG - Intronic
916202302 1:162283732-162283754 CAGTCTGCAGGTGGTGTTCCAGG + Intronic
916256473 1:162792818-162792840 CAACCTGCAGTCGGTCTTCCGGG + Exonic
918011498 1:180591265-180591287 CACCCTGCAGGTGGTTTTCCAGG + Intergenic
919887076 1:201942377-201942399 CTTCCTCCAGGTAGTCTTCCAGG - Intronic
920097734 1:203497573-203497595 CAGCCTCCAGGAGGGCATCAGGG - Intronic
920550240 1:206854630-206854652 CAGGCTCCAGGTAGCCTTCCTGG + Intergenic
921078767 1:211721996-211722018 CATCCTCCAGGAAGTCTTCCTGG + Intergenic
921290576 1:213653061-213653083 CATCTTCCAGGGGGTCTCCCTGG - Intergenic
921998166 1:221444471-221444493 CAGCATCCTGGCTGTTTTCCAGG + Intergenic
922726552 1:227925552-227925574 CAGGCTCCAGCAGGGCTTCCTGG - Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
922868865 1:228883973-228883995 CAGCCTTCAGGCTGTTTTTCTGG - Intergenic
924760488 1:246980151-246980173 CAGAGTCCAGGCTGTCGTCCAGG - Intronic
1067213657 10:44282170-44282192 CAGCTTCCAGCTTGTCTTCCAGG - Intergenic
1069705679 10:70457995-70458017 AATCCTCCAGGCTGGCTTCCTGG - Intergenic
1071835744 10:89415271-89415293 GAGCCCCCAGGCGCTGTTCCGGG + Intronic
1072048334 10:91679371-91679393 CAGACTCCAGGGGGCCTTCTAGG + Intergenic
1073149787 10:101303896-101303918 CTTCCTCCAGGCTGTCTTCCAGG + Intergenic
1073824839 10:107308587-107308609 CAGCCTTCATGCTGTGTTCCGGG - Intergenic
1075236853 10:120738385-120738407 CTGACTCAAGGTGGTCTTCCCGG + Intergenic
1075748047 10:124742136-124742158 CAGCTTCCAGGCGCTTTTTCAGG - Intronic
1075855610 10:125626891-125626913 GAGCCTCCAGGAGGTCGTGCTGG - Intronic
1076908233 10:133373634-133373656 CCGCCTCCGCGCGGTCTCCCCGG - Exonic
1077332932 11:1991250-1991272 CGGCCTGCAGGTGGGCTTCCAGG + Intergenic
1077808270 11:5610960-5610982 CAGGATCCAGGCAGTCTTCTTGG - Exonic
1080159881 11:29160862-29160884 CTCCCTCCAGGAGGTCTTCCGGG + Intergenic
1081845005 11:46234343-46234365 CAGCCTCCAGAGGGGCTTTCTGG + Intergenic
1084121464 11:67071500-67071522 CAACGTCCACGCCGTCTTCCAGG + Exonic
1084474843 11:69382929-69382951 CCTCCTCCAGGAAGTCTTCCAGG + Intergenic
1084556828 11:69880536-69880558 CAGCCTCCAGGCTGCCTGTCTGG + Intergenic
1084681422 11:70668686-70668708 CCTCCTCCAGGAAGTCTTCCAGG - Intronic
1084860358 11:72014046-72014068 CAGCCTCGAGGCTGCGTTCCAGG + Exonic
1084942641 11:72621210-72621232 CTGCCTCCAGGAAGCCTTCCTGG + Intronic
1085734032 11:79023764-79023786 GAGCCTTCAGGAGCTCTTCCTGG - Intronic
1090530409 11:127585321-127585343 CAGCCCCCAAGTGGTCTTGCTGG - Intergenic
1090865726 11:130698896-130698918 CTTCCTCCAGGAGGCCTTCCTGG - Intronic
1202815915 11_KI270721v1_random:46426-46448 CGGCCTGCAGGTGGGCTTCCAGG + Intergenic
1102058824 12:109916676-109916698 CAGCCGCCAGGCAGTTTTACAGG + Exonic
1103637908 12:122323580-122323602 CAGCCTCCAGGCCGCTCTCCAGG - Intronic
1103994802 12:124822065-124822087 CCTCCTCCAGGCAGCCTTCCTGG - Intronic
1105210298 13:18253375-18253397 CAGGCTCCAGGTGGCCTCCCTGG - Intergenic
1105839503 13:24241628-24241650 CAACCACCAGGTGGGCTTCCTGG - Intronic
1109521034 13:63511331-63511353 CAGCCTGAAGGGGGTCTTCCTGG - Intergenic
1115245791 14:31293412-31293434 CAGCCTCAAGGCGGGCTTTTAGG + Exonic
1115528277 14:34302678-34302700 CAGCCTCCAGCGGGGCTTGCGGG + Intronic
1115640561 14:35333148-35333170 CAGCTTCCAGGCCTCCTTCCTGG + Intergenic
1117841821 14:59869444-59869466 CAGCCTCAAAGCGCGCTTCCTGG + Intronic
1118902994 14:70002178-70002200 CTCCCTCCAGGGGGTCCTCCCGG + Intronic
1120191731 14:81446031-81446053 CACACTCCAGGCAGTCCTCCTGG - Intergenic
1121092179 14:91190515-91190537 CCTCCTCCAGGAGGTCTTCCTGG - Intronic
1121310450 14:92932755-92932777 CCGCCTCAAGGCTGTCCTCCCGG - Exonic
1121416038 14:93779911-93779933 CAGCATCCAGGTGGTCTTGTGGG + Intronic
1121545114 14:94757506-94757528 CTTCCTCCAGGCAGTCTTCATGG - Intergenic
1121656223 14:95597794-95597816 CAGCCTCCAGGGGCTGCTCCTGG + Intergenic
1121691088 14:95877320-95877342 CAGCCTCCAGGCGGGGCTTCGGG - Intergenic
1122019103 14:98821557-98821579 CCACCTCCAGGAGGTCTCCCTGG + Intergenic
1122454776 14:101841810-101841832 CAGCCTCCTGGCTGTCCACCTGG - Intronic
1122718697 14:103710074-103710096 CAGCCGCCTGGCTGTCATCCGGG - Intronic
1123043157 14:105498829-105498851 CCGCCTCCAGGCAGGCCTCCTGG - Exonic
1124027647 15:25981736-25981758 CAGCCTGCAGGGGGTCTGCAGGG + Intergenic
1125323900 15:38516525-38516547 CAGCCTCCAGGAGGTCTTGCTGG + Intronic
1127505687 15:59595844-59595866 CTTCCTCCAGGATGTCTTCCCGG + Intronic
1128115498 15:65102405-65102427 CAGCCTCCAACCGGGCTCCCCGG - Exonic
1128261914 15:66238503-66238525 CTGCCTCCAGGCGGTGCTCCTGG - Intronic
1128693506 15:69743396-69743418 CAAACTCCAAGCTGTCTTCCAGG + Intergenic
1129052901 15:72797259-72797281 CCGCCTCCGGGCAGCCTTCCCGG + Intergenic
1129869082 15:78929379-78929401 CAGCCTCCACTCTGTCTTCTTGG - Intronic
1131175911 15:90209720-90209742 CCTCCTCCAGGAGGCCTTCCTGG - Intronic
1131231175 15:90660748-90660770 TAGCCTCCAGGCTTTCTCCCGGG + Intergenic
1132361379 15:101219001-101219023 CAGGCTCCAGTCGGCCTGCCTGG + Intronic
1132461670 16:58471-58493 CATCTTTCAGGTGGTCTTCCTGG - Exonic
1133271444 16:4612694-4612716 CATCCACCAGGCGGTGTTTCTGG - Intronic
1133283863 16:4681606-4681628 CGGCCTCCGGGCTGTCTCCCCGG + Exonic
1135025418 16:18995614-18995636 CAGCGGCCAGGCGTTCCTCCAGG - Intronic
1141560243 16:84863023-84863045 CCGCCTCCAGGGAGCCTTCCTGG + Intronic
1142130497 16:88429690-88429712 CAGCAGCCTGGCGGCCTTCCTGG + Exonic
1142236604 16:88925379-88925401 CAGCCTCCAGGAGATCTGCAGGG + Intronic
1142292173 16:89198236-89198258 CCGCCTCCAGGCCGGCCTCCAGG + Exonic
1143521823 17:7448623-7448645 CAGCCTCCAGGCGATCCTAGGGG + Exonic
1143623562 17:8095196-8095218 CAGCCTCAAGTCAGTCTCCCCGG - Intergenic
1144493719 17:15734493-15734515 CACCCTCCAGGCAGCCCTCCAGG - Intronic
1144906546 17:18642186-18642208 CACCCTCCAGGCAGCCCTCCAGG + Exonic
1146942215 17:36851176-36851198 CTGCGTCCAGGCTGTCTTCCGGG - Intergenic
1147562836 17:41519581-41519603 CATCCTCCAGCCTGTGTTCCTGG + Exonic
1148048503 17:44758388-44758410 CGGCCTCCAGGAGGGCTTCAGGG - Intergenic
1148339497 17:46864870-46864892 CAGCCTCCAGGACACCTTCCAGG + Intronic
1149319564 17:55470027-55470049 CAGCGGCCAGGCGTTCCTCCAGG + Intergenic
1150579371 17:66458348-66458370 CAGCGTCTAGGCTGTGTTCCAGG - Intronic
1151206488 17:72511984-72512006 CAGCCTCCTGAAGGACTTCCAGG - Intergenic
1152496533 17:80676708-80676730 CAGCCACCACGCAGGCTTCCAGG - Intronic
1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG + Intronic
1154346019 18:13544210-13544232 CTGCCTCCGGGCTGTTTTCCTGG + Intronic
1156892868 18:42209822-42209844 CAGGCTCCAGGCAGCCTACCTGG + Intergenic
1157135547 18:45050804-45050826 CAGCCTCTAAGCAGGCTTCCTGG + Intronic
1158527377 18:58227347-58227369 GAGTCTCCAGGCAGTCTTCCTGG + Intronic
1159187212 18:64990699-64990721 CAGCCTCAAGGAGGTCCTTCAGG + Intergenic
1160328248 18:77969442-77969464 CAGCCTCCAGGAGCTGCTCCTGG - Intergenic
1160328280 18:77969570-77969592 CAGCCTCCAGGAACTGTTCCTGG - Intergenic
1160328333 18:77969768-77969790 CAGCCTCCAGGAACTGTTCCTGG - Intergenic
1160747433 19:718737-718759 CCTCCTCCAGGCAGCCTTCCAGG - Intronic
1160994026 19:1873564-1873586 CAGCCCCCAGGCGCCCTACCCGG + Intergenic
1161242381 19:3229490-3229512 CCTCCTCCAGGCGGCCCTCCTGG - Intronic
1161343344 19:3754302-3754324 CACCGTCCAGGAGGTCTTCATGG + Exonic
1161967489 19:7556533-7556555 CAGCATCCATCGGGTCTTCCAGG + Exonic
1162016977 19:7851336-7851358 CCGCCTCCAGGGAGCCTTCCTGG - Intronic
1162100260 19:8334839-8334861 CAGCCTCCACGCCGGCCTCCCGG + Exonic
1163162890 19:15476000-15476022 CAGCCTCCTGGCAGTCACCCTGG - Exonic
1163343870 19:16727470-16727492 CAGCAGCCAGGCAGCCTTCCTGG - Intronic
1163444111 19:17336890-17336912 CCTCCTCCAGGAAGTCTTCCTGG - Intronic
1163815860 19:19464056-19464078 CAGCTTCCAGACGGTCTGCCTGG + Intronic
1163829718 19:19541832-19541854 CAGCCTCCAGGCCGTGTTTGTGG - Intronic
1164669252 19:30063469-30063491 CCTCCTCCAGGCAGCCTTCCTGG + Intergenic
1167303766 19:48695642-48695664 CCGCCTCCATGCTGCCTTCCTGG + Intergenic
1167744467 19:51342432-51342454 CCTCCTCCAGGAAGTCTTCCTGG - Intergenic
1167780921 19:51598351-51598373 CTGCCTCCAGGAAGGCTTCCTGG - Intergenic
1168695146 19:58400063-58400085 CCTCCTCCAGGCAGCCTTCCTGG - Intergenic
925969648 2:9097259-9097281 CAGCCTCCCTGGGGGCTTCCAGG - Intergenic
926806629 2:16717237-16717259 CACTCTCCAGGCTGCCTTCCAGG + Intergenic
927501139 2:23584152-23584174 CAGGCTCCAGCCGGCCTCCCAGG + Intronic
929867727 2:45732612-45732634 CTTCCTCCAGGAAGTCTTCCCGG + Intronic
930206756 2:48594668-48594690 CATCCTCCTGGAGGTCCTCCAGG - Intronic
930958374 2:57231117-57231139 CAGCCGCCAGGCATTCCTCCAGG + Intergenic
931107130 2:59068559-59068581 CAGCCTCCCTGAGGTCTCCCTGG - Intergenic
932133968 2:69212410-69212432 CAGCTCCCAGGAGGTGTTCCTGG + Intronic
932431116 2:71674105-71674127 CCTCCTCCAGGCAGCCTTCCAGG + Intronic
932444806 2:71772217-71772239 CAGCCTCAAGCAGGTCTTTCAGG + Intergenic
937268064 2:120629752-120629774 CAGCCTCCAGGAGGGGCTCCTGG + Intergenic
937953982 2:127408727-127408749 CCTCCTCCAGGAAGTCTTCCTGG + Intergenic
938273213 2:129993383-129993405 CAGCCTCCGGGAGGAGTTCCTGG + Intergenic
938443006 2:131352713-131352735 CAGCCTCCGGGAGGAGTTCCTGG - Intronic
939548160 2:143579634-143579656 TAGCCTCTGGGCAGTCTTCCTGG - Intronic
939569953 2:143829353-143829375 CTGCCTCCAGGCAATTTTCCAGG + Intergenic
940409293 2:153341857-153341879 CAGCCTCCAGGTGGTCATTTTGG - Intergenic
941111043 2:161418770-161418792 CAGCCTGCAGCCCGCCTTCCAGG - Intronic
943618890 2:190125070-190125092 CAGCCTCCAGAAGGTCCTTCAGG - Intronic
943806646 2:192132652-192132674 CAGCGGCCAGGCGTTCCTCCAGG + Intronic
944386757 2:199173857-199173879 CAGCCTCAAGAAGGTCTTTCAGG + Intergenic
946371139 2:219282000-219282022 CAGCCCCGAGGAGGTCTTCCGGG + Exonic
948158174 2:235801298-235801320 CCTCCTCCAGGAAGTCTTCCCGG - Intronic
948551384 2:238775165-238775187 CCTCCTCCAGGAAGTCTTCCAGG - Intergenic
1169571623 20:6912721-6912743 CTTCCTCCAGGAGGACTTCCTGG - Intergenic
1170737422 20:19023922-19023944 CAGCCTCGAGTGGGTCTTTCTGG - Intergenic
1171291442 20:23985065-23985087 CAGGCTCCAGGTGGCCTCCCTGG - Exonic
1173313400 20:41920957-41920979 CAGCTTCCAGGAAGACTTCCAGG + Intergenic
1173800218 20:45890601-45890623 CCGCCTCCGGGCGGCCCTCCCGG + Exonic
1173897178 20:46559994-46560016 CAGCCTCAAGGGAGTCCTCCAGG + Exonic
1173922905 20:46759253-46759275 CAGCCTCCTGGTGGTCATCCAGG - Intergenic
1174611521 20:51801781-51801803 CCTCCTCCGGGGGGTCTTCCAGG + Intronic
1175985781 20:62763621-62763643 CCTCCTCCAGGCAGCCTTCCTGG - Intergenic
1176110105 20:63407225-63407247 CATGCTCCCGGCTGTCTTCCGGG + Exonic
1176145266 20:63562635-63562657 GAGCCTCCTGCCGGTCTGCCCGG + Exonic
1176169096 20:63689105-63689127 CACCTTCCTGGCGGTCTGCCGGG + Exonic
1176259328 20:64171374-64171396 CAGGCTCCAGGCAGCCTTCTAGG - Intronic
1176377622 21:6094279-6094301 CAGACTCCAGACGGGCCTCCTGG - Intergenic
1177894044 21:26840505-26840527 CAGCTCCCAGGCGATCTCCCTGG - Exonic
1179106321 21:38403817-38403839 CAGCCTCCAGCCAGCCTCCCTGG + Intronic
1179412345 21:41171453-41171475 CAGCTCTCAGGCGGGCTTCCGGG - Intronic
1179745853 21:43443965-43443987 CAGACTCCAGACGGGCCTCCTGG + Intergenic
1180087806 21:45515903-45515925 CAGCCCCCAGGCTGTCTTCTGGG + Exonic
1180765957 22:18346028-18346050 CAGGCTCCAGGTGGCCTCCCTGG + Intergenic
1180780356 22:18516350-18516372 CAGGCTCCAGGTGGCCTCCCTGG - Exonic
1180813072 22:18773671-18773693 CAGGCTCCAGGTGGCCTCCCTGG - Intergenic
1181178803 22:21053188-21053210 CAGCCACCAGGGGGTCTGCATGG + Intronic
1181199249 22:21207987-21208009 CAGGCTCCAGGTGGCCTCCCTGG - Exonic
1181702496 22:24628968-24628990 CAGGCTCCAGGTGGCCTCCCTGG + Exonic
1182101886 22:27663229-27663251 CAGCCTCCAGGCCTTCACCCTGG + Intergenic
1182480444 22:30605499-30605521 CCTCCTCCAGGCTGCCTTCCTGG + Intronic
1183392437 22:37553102-37553124 CCTCCTCCAGGCAGTCTTCCTGG + Intergenic
1183671328 22:39274523-39274545 CAGCCTGCAGGCCTTTTTCCAGG - Intergenic
1184057392 22:42061509-42061531 CATCCTCCAGAAGGTTTTCCAGG + Intronic
1184831534 22:46991936-46991958 CACCCTCCAAGTGGTCTTCCAGG + Intronic
1185254444 22:49824694-49824716 CAGCATGCAGGCGGTCCCCCAGG + Exonic
1203227576 22_KI270731v1_random:86919-86941 CAGGCTCCAGGTGGCCTCCCTGG + Intergenic
950402033 3:12776346-12776368 CAGCCTCCTGGAGGCCTTCGTGG - Intergenic
950476729 3:13219565-13219587 CACCCACCCGGCGGTCTTCGGGG + Intergenic
950581612 3:13866000-13866022 CCTCCTCCAGGAGGTCTTCCTGG - Intronic
950679122 3:14572980-14573002 CATCTTTCAGGTGGTCTTCCTGG - Intergenic
952975364 3:38689913-38689935 CAGCCTCAAGCAGGTCTTCCAGG + Intergenic
953465679 3:43117353-43117375 CAGCCTCTAGACGGGCTTCTAGG + Intergenic
953867333 3:46595627-46595649 CAGCCTCAAGGCGGGCTTCATGG - Intronic
954745193 3:52783830-52783852 CCTCCTCCAGGAGGCCTTCCCGG - Intronic
956643263 3:71434343-71434365 CAGCCTGCAGGTGGACTCCCAGG - Intronic
957155121 3:76536133-76536155 CAGCCTCCAGGCATTCCTTCAGG - Intronic
959483830 3:106905804-106905826 CAGCCTCCTTGAGGTCTTCCAGG - Intergenic
962959952 3:140301758-140301780 CAGCCTCCAGGAGGAGTACCTGG - Intronic
965530339 3:169764804-169764826 CGGCCTCCAGGCGGGGTTCGGGG + Intergenic
967668772 3:192206856-192206878 CAGCTTCCAGGGGGCCCTCCAGG - Intronic
967887317 3:194342030-194342052 CAGCCTGCAGGAGCTCTTCCTGG - Exonic
968439110 4:612656-612678 CAGGCTCCTGCTGGTCTTCCTGG - Intergenic
968618797 4:1594274-1594296 CCACCTCCAGGAAGTCTTCCAGG - Intergenic
968896956 4:3409875-3409897 CAGCCTCCAGGCCACCCTCCAGG + Intronic
968903491 4:3441712-3441734 CCTCCTCCAGGAAGTCTTCCAGG - Intergenic
968968651 4:3782136-3782158 CTGCCGCCAGGCGGTCGTTCAGG + Intergenic
968982549 4:3858213-3858235 CAGCAGCCAGGAGGGCTTCCTGG - Intergenic
969131389 4:4993400-4993422 CAGCCTCCTGGGGGGCTCCCTGG + Intergenic
969711501 4:8846832-8846854 CCTCCTACAGGCAGTCTTCCTGG + Intronic
969718183 4:8878428-8878450 CATCCTCCAGGCGGTTTCCTGGG - Intergenic
969720704 4:8891919-8891941 CCTCCTCCAGGCAGTCTTCCCGG + Intergenic
971822957 4:31582984-31583006 CAGCCTCAAGTAGGTCCTCCAGG + Intergenic
972983053 4:44728524-44728546 CAGCCTCAAGGAGGTCTTTCAGG + Intergenic
978031477 4:103943366-103943388 CAGTGGCCAGGCGTTCTTCCAGG + Intergenic
979274401 4:118799092-118799114 CAGCCTCCACATGGTCTCCCTGG - Intronic
979666513 4:123316865-123316887 AAGCCTCCTTGTGGTCTTCCTGG - Exonic
981721485 4:147806192-147806214 CAGAGTCCAGGCGGCTTTCCAGG + Intronic
984506128 4:180621302-180621324 CTGTCTCCAGGCGTTCTTCCAGG + Intergenic
985727075 5:1522242-1522264 CAGCCACCAGGCTCTCTCCCTGG - Intronic
992058003 5:73011962-73011984 CAGCCTCCAGCAGGTCCTTCAGG - Intronic
994194026 5:96901628-96901650 CTTCCTCCAGGGGGTTTTCCAGG + Exonic
994722866 5:103400896-103400918 CAGCTTCCTGCCTGTCTTCCAGG - Intergenic
998746707 5:145268444-145268466 CATCCTCCATGCCGCCTTCCTGG + Intergenic
998848654 5:146334460-146334482 CAGGCTCCAGGCATGCTTCCGGG - Intronic
999436358 5:151566517-151566539 CAGCTTCCAGGAGGACTTCTGGG + Exonic
1000047401 5:157533043-157533065 CAGCCTCTTGGTGGGCTTCCAGG - Intronic
1001407621 5:171487048-171487070 CAGCCTCCATGCAGTCATTCAGG - Intergenic
1001440310 5:171737791-171737813 GAGCCTCCAGCCGCTCCTCCCGG + Intergenic
1001605725 5:172958702-172958724 GGGCCTCCAGGCAGTCTTCCAGG + Intergenic
1002065627 5:176650332-176650354 CAGCCTCCAGCAGGAGTTCCTGG - Intronic
1002066058 5:176652274-176652296 CAGCCTCCAGCAGGAGTTCCTGG - Intronic
1002333971 5:178465520-178465542 CAGCCTCGAGGAGGCCCTCCTGG + Intronic
1002419579 5:179138654-179138676 CAGGCTCCAGGCTGCCCTCCCGG - Intronic
1004271429 6:14199561-14199583 CAACCTCCATGGGGCCTTCCTGG - Intergenic
1006169358 6:32084308-32084330 CTGCCTCCAGGAAGCCTTCCCGG + Intronic
1006319736 6:33313434-33313456 CTGCCTTCAGGCGGTATCCCCGG - Exonic
1007622083 6:43221451-43221473 CAGCCTCCACGGTGACTTCCTGG + Intronic
1007944459 6:45813075-45813097 CAGCCTCCAAGCCGTCTCCAGGG - Intergenic
1008589315 6:52977231-52977253 CTGCCTCCTGGCAGTCTGCCTGG + Intergenic
1011032614 6:82940123-82940145 TAACCTCCAGGCTGTCTGCCTGG + Intronic
1012675092 6:102104181-102104203 CAGCGGCCAGGCGTTCCTCCAGG + Intergenic
1015181360 6:130365700-130365722 CCGCTTGCAGGCGCTCTTCCCGG - Intergenic
1015629690 6:135219509-135219531 CCCCCTCCAGGCGGCCTTCCAGG - Intergenic
1015730108 6:136338698-136338720 CAGCCTCCAGGAGGTGCTACAGG - Intergenic
1019371794 7:665983-666005 CACCCTTGAGGCGGCCTTCCTGG - Intronic
1020085655 7:5308904-5308926 CAGCCTCCCGGCGGCCCTGCGGG - Exonic
1022474540 7:30701359-30701381 CTTCCTCCAGGCAGCCTTCCTGG + Intronic
1023681697 7:42694018-42694040 CAGCCTCCAGGTGTGATTCCCGG + Intergenic
1023802392 7:43846274-43846296 CAGCCCCCAGGTGGGCTGCCTGG - Intergenic
1023845188 7:44116465-44116487 CAGCCTCCACGCTGGCTGCCTGG + Exonic
1024023485 7:45391643-45391665 CCGCCTCCAGGCAGGCCTCCAGG + Intergenic
1024074273 7:45810776-45810798 ATGCCTCCCGGCGGCCTTCCCGG + Intergenic
1024923471 7:54586803-54586825 CAGCCTCCGGCAGGTCCTCCAGG - Intergenic
1025053139 7:55744752-55744774 ATGCCTCCCGGCGGCCTTCCCGG - Intergenic
1025208654 7:57008260-57008282 CAGCCTCCCGGCGGCCCTGCAGG + Intergenic
1025663293 7:63568618-63568640 CAGCCTCCCGGCGGCCCTGCAGG - Intergenic
1026787837 7:73313043-73313065 CACCTTCCAGGCCGACTTCCAGG - Exonic
1028589917 7:92483274-92483296 CAGCAGCCAGGCGTTCCTCCAGG - Intergenic
1028981312 7:96970735-96970757 CAAGCTCCATGGGGTCTTCCAGG + Intergenic
1032095911 7:128938431-128938453 CAGCCTCCAGCGGGGCTCCCGGG - Intronic
1033084712 7:138331253-138331275 CAGCAGCCAGGCGTTCCTCCAGG + Intergenic
1033597991 7:142870250-142870272 CCGCCTCCAGGCTGTCCTCCTGG + Exonic
1033853462 7:145526879-145526901 CAGGATCCAGACGGTCTTGCAGG + Intergenic
1034283953 7:149872536-149872558 CCTCCTCCAGGGAGTCTTCCTGG + Intergenic
1035640079 8:1178145-1178167 CTGCCTTCAGGCAGTCCTCCGGG - Intergenic
1036578893 8:10054609-10054631 CAGCCCCCAGGAGGCCTTGCCGG + Exonic
1037794862 8:21984652-21984674 TATCCTCCAGGGGATCTTCCAGG - Exonic
1037861569 8:22409142-22409164 CAGCCTCCGGGAGGTCTTAAAGG - Intronic
1039531846 8:38269312-38269334 CAGCCGCCAGGCCGTCTTCCTGG - Intronic
1039762385 8:40591493-40591515 CAGCCTCCAGTTTGTCCTCCTGG + Intronic
1040558672 8:48504254-48504276 CTGCCTCCAGCCGGGCTTGCAGG - Intergenic
1042217400 8:66439653-66439675 GAGCCTCCAGGAGAACTTCCTGG - Intronic
1047759337 8:127942502-127942524 CAGCCTTCAGGGGCTCTTCCAGG - Intergenic
1049331791 8:142058523-142058545 CCGCCTGCAGGAAGTCTTCCAGG - Intergenic
1049382556 8:142324764-142324786 CAGCCTCCATGCCAGCTTCCAGG + Intronic
1049384015 8:142331790-142331812 CAACCTCCAGGAGCTGTTCCAGG - Exonic
1049510522 8:143024703-143024725 CAGCCCCCAGCAAGTCTTCCTGG + Intergenic
1049659859 8:143815104-143815126 CAGCCTCCAGCCGGCCCTGCTGG - Intronic
1051587621 9:18743622-18743644 CAGCGTGCAGGCAGACTTCCAGG + Intronic
1052343432 9:27384907-27384929 CAGCCTCCAGTCCCTCTGCCAGG + Intronic
1053415562 9:37944954-37944976 CAGCCTCCAGGGGCTCAGCCTGG - Intronic
1056543293 9:87592705-87592727 CAGCCTCGTGGCTGACTTCCAGG + Intronic
1056720274 9:89065218-89065240 CAGGCAGCAGGTGGTCTTCCAGG + Intronic
1056924619 9:90822633-90822655 CATCCACCAGGCGGTCCTCCTGG + Intronic
1057489117 9:95508270-95508292 CCGCCTCCAGCCGGCCGTCCCGG + Exonic
1057724732 9:97560335-97560357 CCTCCTCCAGGGAGTCTTCCTGG - Intronic
1060137754 9:121173719-121173741 CAACCTTGAGTCGGTCTTCCCGG - Exonic
1060199397 9:121643677-121643699 CCTCCTCCAGGCAGTCTTCCAGG + Intronic
1060396323 9:123319315-123319337 CTGACTCCTGGCTGTCTTCCTGG - Intergenic
1060560655 9:124540032-124540054 CAGGCTCCACACTGTCTTCCAGG - Exonic
1060740022 9:126091895-126091917 AAGCCTCCAGGCTCTGTTCCAGG - Intergenic
1061398403 9:130355595-130355617 CTTCCTCCAGGAGGCCTTCCAGG - Intronic
1061874833 9:133538477-133538499 CAGTTTTCAGGGGGTCTTCCAGG + Intronic
1062450842 9:136615069-136615091 CAGCCTCCAGCCGCTCTCCGAGG + Intergenic
1062535142 9:137018143-137018165 AATCCTCCAGCCGGTCTTCCGGG + Intronic
1185714793 X:2332629-2332651 CAGCCTCCAGTCACTCTGCCAGG + Intronic
1187170014 X:16841667-16841689 CAGCCTCCAGGTGCGCTCCCAGG - Exonic
1188448989 X:30289317-30289339 CAGACTCAAGACTGTCTTCCAGG + Intergenic
1193372921 X:80720225-80720247 CAGCCTCAAGAAGGTCCTCCTGG + Intronic
1195016959 X:100789904-100789926 CAGCAGCCAGGCGTTCCTCCAGG - Intergenic
1199720777 X:150541554-150541576 CAGACTCATGGGGGTCTTCCAGG - Intergenic