ID: 1152677812

View in Genome Browser
Species Human (GRCh38)
Location 17:81650743-81650765
Sequence GGTCCAGCAGGCTCCCGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152677800_1152677812 13 Left 1152677800 17:81650707-81650729 CCCTAGCTTTCCAGCTGGGAGGA 0: 1
1: 0
2: 0
3: 16
4: 221
Right 1152677812 17:81650743-81650765 GGTCCAGCAGGCTCCCGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152677805_1152677812 3 Left 1152677805 17:81650717-81650739 CCAGCTGGGAGGAGGGGACGATC 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1152677812 17:81650743-81650765 GGTCCAGCAGGCTCCCGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152677797_1152677812 17 Left 1152677797 17:81650703-81650725 CCTGCCCTAGCTTTCCAGCTGGG 0: 1
1: 0
2: 2
3: 29
4: 256
Right 1152677812 17:81650743-81650765 GGTCCAGCAGGCTCCCGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 238
1152677801_1152677812 12 Left 1152677801 17:81650708-81650730 CCTAGCTTTCCAGCTGGGAGGAG 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1152677812 17:81650743-81650765 GGTCCAGCAGGCTCCCGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152677812 Original CRISPR GGTCCAGCAGGCTCCCGGGC TGG Exonic