ID: 1152681036

View in Genome Browser
Species Human (GRCh38)
Location 17:81668044-81668066
Sequence GAGGCTTGGAAGGAGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 488}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152681026_1152681036 25 Left 1152681026 17:81667996-81668018 CCAAAGCTAAAGCAGTGGCTGGC 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG 0: 1
1: 0
2: 3
3: 48
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152681036 Original CRISPR GAGGCTTGGAAGGAGGCTGT GGG Intronic
900407337 1:2498429-2498451 GGGGCTGGGGAGGGGGCTGTTGG + Intronic
900478249 1:2886220-2886242 TTGGCTTGGATGGAGGCTGCGGG + Intergenic
900605254 1:3520995-3521017 GAGGCTTGCAGAGAGGCTGGTGG - Intronic
901055304 1:6446383-6446405 GAGGGCTGGAAGGAGGGTGGGGG + Intronic
901404976 1:9039510-9039532 GGGCCTTGGGTGGAGGCTGTGGG + Intronic
901634485 1:10664253-10664275 AAGGCTGGGAAGGAGGCCGGGGG + Intronic
902686427 1:18080504-18080526 GGGGGCTGGAAGGAGGCGGTGGG + Intergenic
902772164 1:18651767-18651789 GAAGCCTGGAGGGAGGGTGTTGG - Intronic
902810149 1:18883461-18883483 GAGGATGGACAGGAGGCTGTTGG - Intronic
902872557 1:19323280-19323302 GAGGCTTGTTAGGAGGCTGAGGG + Intronic
902927058 1:19702947-19702969 GAGGATTGGATAGAGGCTGAGGG - Intronic
902929974 1:19724057-19724079 GAGTCTTGGAAAGAGCCTGGGGG + Intronic
904581898 1:31549711-31549733 GGGGACTGGGAGGAGGCTGTGGG - Intergenic
904587558 1:31588633-31588655 GAGGCTTGGGAGGGGCCTGGAGG - Intergenic
904652065 1:32013476-32013498 GAGCAGTGGAGGGAGGCTGTGGG - Intergenic
904703424 1:32372880-32372902 GTGGCCTGGAAGGAGCCTGGAGG - Intronic
904997483 1:34642250-34642272 GAGGTCAGGAAGGAGGCTCTTGG - Intergenic
905030219 1:34877315-34877337 GTGGCCTGGAAGGAGGATGCTGG + Intronic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
905811561 1:40917026-40917048 GAGGCTGGGCAGGAGGGTGGAGG + Intergenic
906382728 1:45343045-45343067 GAGGCTTAGAAAGAGGCTCCAGG - Intronic
907512186 1:54969998-54970020 GAGGTTTAGGAGGAGGCTCTAGG + Intergenic
908267447 1:62393387-62393409 GTGGCTTGGGAAGAAGCTGTTGG - Intergenic
908321648 1:62984361-62984383 GAGGCATTGAAGGAGTGTGTTGG + Intergenic
908450080 1:64245688-64245710 GTGGCTTTGAAGGAGGCTGATGG - Intronic
909394272 1:75152126-75152148 AATGCTAGGAAGGAGGCTGAGGG - Intronic
909436671 1:75650197-75650219 GAGGCTGGGAAGAGGGCTGAGGG - Intergenic
909595326 1:77399816-77399838 GAGGTTTAGAAGGCTGCTGTGGG + Intronic
910429314 1:87145612-87145634 GAGGCTGGGGAGGAGGGAGTGGG - Intronic
910653045 1:89590608-89590630 GAGATTTGGAAGGAGACTGGTGG + Intronic
911283579 1:95961269-95961291 GAGGCTGGGAAGGATACTGGAGG - Intergenic
911716089 1:101134769-101134791 GAGGGGTGGCAGGAGCCTGTAGG - Intergenic
911778327 1:101843238-101843260 GAGGCCTCGAAGGAACCTGTGGG - Intronic
912504213 1:110144597-110144619 GAGGCTTGGCTGGAGGCTGGAGG + Intergenic
913594251 1:120358621-120358643 GAGGCCTGGAAGGATTTTGTTGG - Intergenic
914093011 1:144520375-144520397 GAGGCCTGGAAGGATTTTGTTGG + Intergenic
914305518 1:146413509-146413531 GAGGCCTGGAAGGATTTTGTTGG - Intergenic
914596539 1:149159297-149159319 GAGGCCTGGAAGGATTTTGTTGG + Intergenic
915623973 1:157103369-157103391 GAGGCTGGGGAGGAGACTGCTGG - Intergenic
915643464 1:157248692-157248714 GAAGATTGGAAGGAGGGTGAGGG + Intergenic
915735023 1:158078974-158078996 GAGGCTTGGAGAGAGGCTGGGGG - Intronic
915915672 1:159939136-159939158 GAGACTGGCAAGTAGGCTGTTGG - Intronic
916214320 1:162382801-162382823 AAGGCCTGGAAAGAGCCTGTTGG - Intronic
916492170 1:165311608-165311630 AATTCTGGGAAGGAGGCTGTTGG - Intronic
916605400 1:166337600-166337622 TAGCCTTGGAATGAGGCTGCTGG - Intergenic
922224324 1:223632144-223632166 GAGGCTCGAAGGGATGCTGTGGG + Intronic
922613862 1:226949197-226949219 GAGGCTGGAAAGGAGGCCGGGGG + Intronic
922846714 1:228691165-228691187 GAGGCCTGGAAAGAGGATATGGG - Intergenic
922903279 1:229154862-229154884 GATGCAGGGAAGGAAGCTGTCGG + Intergenic
1062997452 10:1880474-1880496 GAGGCTTTGTTGGAGGCTCTGGG + Intergenic
1063818258 10:9802650-9802672 AATGCTTGGAAGTAGGCAGTAGG - Intergenic
1064349686 10:14565770-14565792 GAGGCTGCAAAGGAGGCTGAAGG + Intronic
1065562378 10:26976800-26976822 GAGACTTGGAAGGAGTGTGGGGG - Intergenic
1067177636 10:43961283-43961305 GAGGACTGGAAGGAGACTGCTGG + Intergenic
1067263471 10:44715007-44715029 TAGGATTGGAAGTGGGCTGTGGG - Intergenic
1067421233 10:46150915-46150937 GAGGCTTGTAAGCTGACTGTGGG - Intergenic
1067542630 10:47166707-47166729 GAGCCGAGGAAGGAGGCTCTGGG + Intergenic
1068799877 10:61128184-61128206 GTGTTTTGCAAGGAGGCTGTGGG + Intergenic
1069047746 10:63761156-63761178 CAGGCTGGGAAGGACACTGTAGG + Intergenic
1069591661 10:69645758-69645780 GGGGCCTGGAAGGACACTGTGGG - Intergenic
1069777348 10:70934786-70934808 GAGGCTGGGAAGGCGGCCTTGGG - Intergenic
1069849242 10:71394450-71394472 GAGGCCTGGAATGAGGGGGTGGG - Intergenic
1069907114 10:71738452-71738474 AAGGAGGGGAAGGAGGCTGTAGG + Intronic
1071406293 10:85336224-85336246 GAGGCTGGGAAGGATACTGGGGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072032651 10:91536423-91536445 GAGGCTTGGCTGGAGGCTTCAGG - Intergenic
1072192746 10:93089630-93089652 GAGGCTCAGAACGGGGCTGTTGG - Intergenic
1072210977 10:93246871-93246893 GAGACTTGAGTGGAGGCTGTAGG - Intergenic
1072976214 10:100061077-100061099 GAGGCTGGGAAGGATGGTGGGGG + Intronic
1073008694 10:100343543-100343565 AGGGCTTGGAAGGAGGATGGAGG - Intergenic
1073197986 10:101710503-101710525 GAGGCTTGAGGGGAGGCTGAAGG + Intergenic
1074110995 10:110422841-110422863 GAGGGAAGGAAGGAGGCTATAGG + Intergenic
1074411182 10:113230164-113230186 TGGACTTGGGAGGAGGCTGTGGG + Intergenic
1074833612 10:117267837-117267859 GAATCTTAGAAGGAGGCTGCAGG + Intronic
1075013600 10:118894790-118894812 GAGGATGTGAAGGAGGCTTTGGG - Intergenic
1075300895 10:121323179-121323201 CAGGCTGGGAAGGAGGGGGTGGG + Intergenic
1075679892 10:124324367-124324389 GAGGCTTTGAAAGAGGGGGTGGG - Intergenic
1075737521 10:124673176-124673198 GAGGCCAGGCAGGAGGCTATTGG - Intronic
1076102961 10:127797600-127797622 GAGGGATGGATGGAGGGTGTGGG - Intergenic
1076324914 10:129613702-129613724 GAGTCTTGGCGGGAGGCTGGTGG + Intronic
1076531727 10:131149400-131149422 GGGGCCTGCAGGGAGGCTGTGGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077141554 11:1027035-1027057 GGGGCCTGGCAGGAGGCTGCAGG + Exonic
1077482262 11:2821299-2821321 GAGGATGGGAAGGTGGCCGTGGG + Intronic
1077938726 11:6817830-6817852 GAGGCATGGCAGAAGGCTGCAGG + Intergenic
1077994552 11:7442149-7442171 GAGACATGGCAGGAGGCGGTGGG - Intronic
1078127310 11:8580463-8580485 GAGGCTGGGAAGGAGAATGGAGG + Intronic
1078240762 11:9529344-9529366 GAGGCTCAGAAAGGGGCTGTTGG + Intergenic
1078729893 11:13964384-13964406 GAGCCTTGGACGGAAGCGGTGGG + Intronic
1080601320 11:33822743-33822765 GAGGCTAGGAAGGATACTGAGGG - Intergenic
1082687751 11:56260617-56260639 GAGCATGGGAGGGAGGCTGTGGG - Intergenic
1083184477 11:61009180-61009202 GAGGCCTCTGAGGAGGCTGTTGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1083266661 11:61550148-61550170 GAGGCTCAGGAGGAGGCTGTGGG - Intronic
1083463460 11:62830885-62830907 TAGGCTTGGATGGGGCCTGTAGG - Intronic
1083938718 11:65883653-65883675 GGGGCTGGCAAGGAGGCAGTTGG - Exonic
1084054525 11:66623994-66624016 GAGAATGGGAAGAAGGCTGTAGG + Intronic
1084208495 11:67609796-67609818 GAGCCCTGGAAGGAGGCTTTGGG - Intronic
1084308041 11:68299281-68299303 GGGGCTTGGGTGGAGGCTGCTGG + Intergenic
1085206208 11:74733518-74733540 GAGACCTGGTAAGAGGCTGTTGG - Intergenic
1086157036 11:83678720-83678742 GTGGCTTTAGAGGAGGCTGTAGG - Intronic
1086772223 11:90780750-90780772 GAGACTTGGAAGGAGGTGATTGG - Intergenic
1087234786 11:95705877-95705899 GAGGTTTGGAAGGAGAATTTCGG + Intergenic
1088005703 11:104937246-104937268 GAGGCTAGGAAGCATACTGTGGG + Intergenic
1088175458 11:107048395-107048417 GAGGCTGGGGAGCAGGCTGGAGG - Intergenic
1088192432 11:107240805-107240827 GATATTTGGAAGGAGGCAGTAGG - Intergenic
1088457097 11:110044328-110044350 GAGGAATGGAAGGAGGCAGAGGG - Intergenic
1088883100 11:113987004-113987026 GTGGCTTGGGAGGTGGCTGGGGG - Exonic
1088888973 11:114030026-114030048 GAGGCTTGGGAGTAGGATGAAGG - Intergenic
1089531466 11:119132589-119132611 GAGGGCAGGAGGGAGGCTGTGGG - Intronic
1089898535 11:121956873-121956895 GAGGACTGGAAAGAGGCTGTTGG + Intergenic
1090049892 11:123368759-123368781 GAGGATTGGAAAGAGGCCATTGG + Intergenic
1090471136 11:126982268-126982290 GAGACTTGTAAGGTGGGTGTGGG + Intronic
1090594745 11:128309363-128309385 CAGTCATGGAAGGAGGCTGGAGG + Intergenic
1091370731 11:135056078-135056100 GAGGCTTGGAAGGTGCAGGTGGG + Intergenic
1092758217 12:11784667-11784689 AGGACTTGGGAGGAGGCTGTAGG + Intronic
1096355563 12:50938160-50938182 GAAGCTTGGAAGGGGCCTGCAGG - Intergenic
1096449803 12:51728912-51728934 GTGGCTTGAATGGAGGCTGTTGG - Intronic
1096555190 12:52399598-52399620 GAGGCGTGGGAGGAGGCTAGTGG - Intronic
1098089445 12:66885366-66885388 GAGGCTTAGAAAGGGGCTGAGGG + Intergenic
1099413228 12:82358135-82358157 GAAGCTTGGAAGAAGGATTTAGG - Intronic
1099592973 12:84619743-84619765 TAGGAATGGAAGGAGGCTTTAGG - Intergenic
1099872259 12:88364628-88364650 GAGGCTGGGAAGTAGGTAGTGGG - Intergenic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1101492038 12:105218642-105218664 CAGGCTGGGAATGAGGCAGTGGG + Intronic
1101897538 12:108767777-108767799 CAGGCCTGGAAGGAGGGTGGAGG + Intergenic
1102436827 12:112930583-112930605 GAGGCTGAGGAGGGGGCTGTAGG - Intronic
1102448932 12:113026100-113026122 CAGACTTGGAAGGTGGCAGTGGG - Intergenic
1102815119 12:115859191-115859213 GAGGTTTGGAATGAGGCTAAGGG - Intergenic
1103286589 12:119806632-119806654 AGGGATTGGAAGGAGGTTGTTGG - Intronic
1103795379 12:123499634-123499656 GAGGCTGGGGAGGAGGCCGGGGG - Intronic
1103995531 12:124827633-124827655 CAGGATAGCAAGGAGGCTGTGGG - Intronic
1104462425 12:128966501-128966523 GAGGTTGGGGAGGAGGGTGTGGG - Intronic
1104510204 12:129370429-129370451 GAGGCTTGGTGGGAGGCGGGAGG + Intronic
1104702408 12:130917263-130917285 GATGCTTGGAAAGAGGCAATCGG + Intergenic
1104934642 12:132357971-132357993 GAGGAGTGGGAGGAGGCTGCCGG + Intergenic
1105206656 13:18231349-18231371 GAGGCTTGGCTTGAGGCTGAGGG - Intergenic
1105242651 13:18621523-18621545 GATGCTTGCTAGGAGGCTGTGGG + Intergenic
1105258359 13:18760239-18760261 GGGGGTTGGAAGGTGGATGTGGG - Intergenic
1105261022 13:18779539-18779561 GGGGGTTGGAAGGTGGATGTGGG - Intergenic
1105263328 13:18796130-18796152 GGGGATTGGAAGGGGGATGTGGG - Intergenic
1105279403 13:18954480-18954502 CAGGCAGGGAGGGAGGCTGTGGG - Intergenic
1105805858 13:23951267-23951289 AATGCAGGGAAGGAGGCTGTGGG - Intergenic
1106824883 13:33509627-33509649 GAGGTTTGGAACCAGGCTGATGG + Intergenic
1108048290 13:46404059-46404081 GACACTTGGGAGGAGGCTCTGGG - Intronic
1108461931 13:50675605-50675627 GAGGCTTGGAAGGATGGAGTAGG - Intronic
1109308741 13:60667676-60667698 GAGCCTTTGGTGGAGGCTGTAGG + Intergenic
1110803589 13:79729044-79729066 GAGTTTTGGGAGGAGTCTGTTGG + Intergenic
1112497259 13:99915116-99915138 GTTTCCTGGAAGGAGGCTGTGGG - Intergenic
1113403831 13:110019949-110019971 GAGGCTGGGAGGGTGGTTGTAGG - Intergenic
1116116464 14:40658022-40658044 GAAGCTGGGAAGGATGCTGGAGG - Intergenic
1118329227 14:64802759-64802781 GAGGCAGGGAAGCAGGCTGCTGG - Intronic
1118556425 14:67028029-67028051 GAGGCTGGGAAGGATGGTGTGGG - Intronic
1118664272 14:68049722-68049744 AAGGCTGGCAAGGAGGCTGTGGG - Intronic
1121051244 14:90820262-90820284 GAGGAGTGGAGGCAGGCTGTAGG + Intergenic
1121255574 14:92528049-92528071 GGGGCGTGGAAGGGGGCTGCTGG + Intronic
1121509733 14:94503473-94503495 GAGGGTTTGGAGAAGGCTGTGGG - Intronic
1122150634 14:99724352-99724374 GAGGCTTGGATGGATGCTGGAGG - Intronic
1122420755 14:101575640-101575662 GAGCCCAGGCAGGAGGCTGTAGG + Intergenic
1202835028 14_GL000009v2_random:71564-71586 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
1123488649 15:20763083-20763105 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1123545145 15:21332156-21332178 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1124098261 15:26669576-26669598 GAGTCTTGGAAAGAGGCTGTGGG - Intronic
1124355774 15:28993753-28993775 GACTCTGGGAAGGAGGCGGTGGG + Intronic
1124498811 15:30208747-30208769 GAGGCCTGAGAGGAGGCAGTTGG - Intergenic
1124636149 15:31366267-31366289 GAGCCCTGAAGGGAGGCTGTAGG - Intronic
1124744768 15:32329929-32329951 GAGGCCTGAGAGGAGGCAGTTGG + Intergenic
1125829651 15:42705067-42705089 CAGGCCTGGAATTAGGCTGTGGG + Intronic
1127136130 15:55925770-55925792 GAGCCTGGGAACGTGGCTGTAGG - Intronic
1127717307 15:61661718-61661740 CAGGTTTGGAAGGATGCTGGAGG - Intergenic
1128410777 15:67394806-67394828 GAATTTTGGAAGGAGGGTGTCGG + Intronic
1128512824 15:68324157-68324179 GAGGTTTGGCAGGGGACTGTGGG + Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1128752108 15:70156998-70157020 GAGACTTGGAAGCAGCCTTTCGG - Intergenic
1129694667 15:77733880-77733902 GAGTCTTGGAAGGAGTTTGAAGG - Intronic
1130163327 15:81424757-81424779 TAGGCTGGTTAGGAGGCTGTTGG - Intergenic
1131511424 15:93051411-93051433 GAGGCCAGGAAGGAAGCTGGTGG - Intronic
1132403634 15:101529092-101529114 GAGGCCTGGGTGGAGGGTGTTGG - Intergenic
1132407632 15:101553709-101553731 GAGACTTGGAAGGTGGATGAAGG - Intergenic
1202953491 15_KI270727v1_random:59427-59449 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1132684463 16:1156520-1156542 GAGGCTTTGCAGGAGGCGGCAGG + Intronic
1132758774 16:1498968-1498990 GGTGCAGGGAAGGAGGCTGTCGG + Intronic
1133442936 16:5835988-5836010 GCTGCTTGGAGGGAGGCTCTGGG + Intergenic
1135403694 16:22183428-22183450 GAGGCTCGGAAGGAGGCATGTGG + Intronic
1135407203 16:22206802-22206824 AAGGCATGGAAGGAGAGTGTGGG + Intronic
1135633353 16:24053581-24053603 GAGGATGGGAAGGAGGCAGGAGG + Intronic
1136133844 16:28242089-28242111 GGAGCTTTGAAGAAGGCTGTGGG + Intergenic
1138608911 16:58107495-58107517 CAGGCTTGTAAAGAGGCTTTAGG + Intergenic
1139392289 16:66612567-66612589 GATGCTTGGCAGGAGGCTCAGGG - Intronic
1141029003 16:80571637-80571659 GAGGCTTGGATGGTGCCAGTGGG - Intergenic
1141331609 16:83116321-83116343 GGGGCGGGGAAGGAGGCTGATGG + Intronic
1141482845 16:84318373-84318395 GAGGCTTGGATGTAGGGTCTGGG - Intronic
1141959149 16:87392706-87392728 GAGGCCTGGGAGGAGGCAGCCGG + Intronic
1142052336 16:87966969-87966991 CAGGCGTGGAAGGAGGCAGAAGG - Intronic
1142625826 17:1191260-1191282 GAAGCTTGGCGGGAGGCTGGCGG - Intronic
1143182017 17:4989287-4989309 GTTGCTTGGAAGGAAGCTGTGGG - Intronic
1143402336 17:6654797-6654819 GAGGCCTGGAAGGAGGCCCAGGG + Intergenic
1143743956 17:8975960-8975982 GAGGCTTTGAAGGAAGCTGGAGG + Intergenic
1143991293 17:10964673-10964695 GAGGCCTGGTAGGAGGTTTTTGG + Intergenic
1144032919 17:11338045-11338067 GAGGCCTGGAACCAGGGTGTAGG + Intronic
1144063317 17:11602440-11602462 CAGGCTTAGGAGAAGGCTGTAGG - Intronic
1144180186 17:12744448-12744470 AAGGCTGGGAGGGTGGCTGTGGG + Intronic
1144307060 17:13978309-13978331 AGGGCTAGGAAGGAGGCTGTTGG - Intergenic
1145019088 17:19416011-19416033 GAGGCTGGGATGGTGGCTGCTGG + Exonic
1145996166 17:29106208-29106230 GAGGCTGGAATGGAGGCTGAGGG + Intronic
1147674771 17:42197429-42197451 GAGGCTGGGAAGGAGTTTGGAGG - Intergenic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1149437418 17:56644812-56644834 GAGGCTTGGAAGTTTGCAGTTGG - Intergenic
1149660488 17:58331944-58331966 GAGGCTGGGACTGAGGCTCTGGG - Intergenic
1149856503 17:60087691-60087713 GGGGCAGGGATGGAGGCTGTAGG + Intergenic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151333269 17:73423757-73423779 AAGGCCTGGAAGGATGCTGGGGG + Intronic
1151791195 17:76307148-76307170 GGGGCTAGGAAGGAGGGGGTGGG + Intronic
1151967417 17:77438588-77438610 GAGGCTTGGAAGGAGGAAGGAGG + Intronic
1151974439 17:77476372-77476394 GTGGCTGGGACGGGGGCTGTAGG - Intronic
1151990576 17:77571436-77571458 GGGGCCGCGAAGGAGGCTGTTGG + Intergenic
1152529278 17:80907572-80907594 GAGGCCAGGGAGGAGGCTGATGG - Intronic
1152681036 17:81668044-81668066 GAGGCTTGGAAGGAGGCTGTGGG + Intronic
1152755049 17:82083729-82083751 GAGGCTAGGCAGGAGGCAGGTGG + Intronic
1153075677 18:1159321-1159343 GAGGATTGGATGTAGGCTGTGGG - Intergenic
1154098707 18:11447523-11447545 GATGCTTGTATGGGGGCTGTTGG - Intergenic
1154425003 18:14265266-14265288 GGGGGTTGGAAGGTGGATGTGGG + Intergenic
1154427722 18:14284654-14284676 GAGGATTGGAAGGCAGATGTGGG + Intergenic
1154430446 18:14304165-14304187 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
1154432688 18:14320492-14320514 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
1154446291 18:14438354-14438376 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1155420880 18:25654737-25654759 GAGGCTTGGAAGAAGACGGTTGG + Intergenic
1157294874 18:46435318-46435340 GAAGCTGGGATGGAGGCGGTGGG - Exonic
1157727784 18:49978182-49978204 GAGGCATGGATGGAGGATGCAGG - Intronic
1158437527 18:57443716-57443738 AAGACTTGGAGGCAGGCTGTGGG + Intronic
1158881411 18:61782921-61782943 TAGGCTGGGAAGGAGGGTCTTGG - Intergenic
1160113057 18:76052155-76052177 CAGACGTGGAAGGAGGCTGCTGG - Intergenic
1160288007 18:77564572-77564594 GAGGCATGCAAGTAGGGTGTGGG - Intergenic
1160432780 18:78823282-78823304 GAGCCCGGGAAGGAGGCTTTGGG - Intergenic
1160613104 18:80104396-80104418 GAGGCTTAAGAGGAGGTTGTGGG - Intergenic
1161356127 19:3820457-3820479 GAGGCTGGGAAGGCTGGTGTGGG + Intronic
1161848461 19:6725840-6725862 AAGACTAGAAAGGAGGCTGTAGG - Intronic
1161949586 19:7460348-7460370 AAGCTCTGGAAGGAGGCTGTGGG - Intronic
1162028552 19:7907667-7907689 GAGCCTGGGGAGGAGGCTGCCGG - Intronic
1163264098 19:16207892-16207914 GAGCCTGGGAAGTAGGCTGTTGG + Intronic
1164583285 19:29448510-29448532 GAGGCCTGGTAGGAGGCATTTGG + Intergenic
1164598114 19:29543523-29543545 GAGGTCCGGGAGGAGGCTGTAGG - Intronic
1164715450 19:30387470-30387492 ATGGCTTGGAAAGAGGCAGTGGG - Intronic
1164799761 19:31067032-31067054 GAGGCTTGGGAGGGGGATATCGG - Intergenic
1165028166 19:32977111-32977133 GAGGCTTGAATGGAGCCCGTGGG + Exonic
1165149756 19:33753690-33753712 GAGGGTTGGTAGGAGGATGGTGG - Intronic
1165309271 19:35020852-35020874 GAGGCCAGGGAGGAGGCTGCTGG + Intronic
1165315980 19:35055684-35055706 GAGGCCAGGGAGGAGGCTCTGGG - Intronic
1166554318 19:43688067-43688089 GAGGCTTGCATGGGGGCTGTAGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166668895 19:44698162-44698184 GAGACTAGGGAGGAGGCTGGTGG + Intergenic
1166676801 19:44746007-44746029 GAGGCTCTGAAGGAGGAGGTGGG - Intergenic
1166703806 19:44897195-44897217 GAGACTAGAGAGGAGGCTGTGGG + Intronic
1167296463 19:48653242-48653264 GAAGCTGAGAAGGAGGCTGTGGG - Intergenic
1168288404 19:55345686-55345708 GGGGCTTAGGAGGAGCCTGTGGG + Intronic
1202637598 1_KI270706v1_random:55784-55806 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
924971291 2:129694-129716 GAGTCTTTGGAGGAGTCTGTAGG + Intergenic
925024252 2:595235-595257 GATGCTTGCCAGGAGGCTGGGGG + Intergenic
925223965 2:2166299-2166321 GAGGCTGGGAGGGAGGCCATAGG - Intronic
925602936 2:5627974-5627996 GAGGCCTGGAAGGATTTTGTTGG - Intergenic
927711066 2:25326577-25326599 GAGGCATTGAAGGAGGAGGTGGG + Intronic
928469819 2:31563075-31563097 GCAGCTGGGAAGGTGGCTGTAGG - Intronic
929997860 2:46840303-46840325 GAGGCCAGGTAGGAGGCTGTTGG - Intronic
930026773 2:47033881-47033903 GAGGCAGGGAAGGAAGCTCTGGG + Intronic
931097489 2:58957589-58957611 GAGGCTTGAAAGGGGGATCTGGG - Intergenic
931300317 2:60973115-60973137 GAGGCCGGGACGGAGGCTTTGGG - Intronic
932438256 2:71715899-71715921 CCGGATTGGAAGGAGGCTGAAGG + Intergenic
932586443 2:73032681-73032703 GCAGCTTGGAAGGAGGCAGAGGG - Intronic
932922978 2:75939028-75939050 GAGCCTTTGAAGGAGTCTTTAGG + Intergenic
933636568 2:84714444-84714466 GAGGCTGGGAAGGAGAATGGAGG + Intronic
934723940 2:96602828-96602850 GAGGCCTTGGAGGAGGCTGCTGG + Exonic
935677698 2:105609862-105609884 GAGGCCTGGAAAGAGGATGTTGG + Intergenic
937315330 2:120928350-120928372 GAGGCTTGGAGGTGGCCTGTTGG - Intronic
937332830 2:121042840-121042862 GAGGCTGGGATGCTGGCTGTGGG + Intergenic
937436471 2:121885795-121885817 AAGGCTTGGATGGAGGCTGCAGG + Intergenic
938140259 2:128789611-128789633 GAGGTTTGGAAGGGGGAGGTGGG - Intergenic
938366196 2:130736564-130736586 GAGGGCTGGGGGGAGGCTGTAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939153235 2:138496656-138496678 GATGCCTGGAGGGATGCTGTAGG + Intergenic
940189822 2:151028777-151028799 TAGGCTTGGCAGGAGGGTCTAGG - Intronic
940398967 2:153224336-153224358 GGGGGTGGGGAGGAGGCTGTGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942978066 2:182043302-182043324 GAGGCTTGGCAGGAAGTTGAGGG - Intronic
944125527 2:196288773-196288795 AGGGCTTGGCAGGATGCTGTGGG - Intronic
946435668 2:219651035-219651057 AAGGCTGGGAAAGAGGCTTTTGG + Intergenic
947498987 2:230658761-230658783 GAGGCCTGGCAGGAAGCTGGTGG - Intergenic
947818900 2:233057312-233057334 GAGGCTTGGAAAGCAGCTGAGGG - Intergenic
948204603 2:236156605-236156627 GAGCCCTGGGTGGAGGCTGTGGG - Intergenic
948263643 2:236622251-236622273 GAGGCTTTGAAGGGGACTGATGG + Intergenic
948567044 2:238893971-238893993 GAGGCTGGGAAGGAGGCACGTGG - Intronic
948740599 2:240043537-240043559 GAGGCTGTGAGGGAGGCTGCTGG - Intergenic
1168918663 20:1512763-1512785 AAGACCTGGAAGGAGGCTGTTGG + Intergenic
1169265702 20:4166206-4166228 GAGGCTTGGGATGAAGCTGCAGG + Intronic
1169425122 20:5490667-5490689 GAGTTTTGGAGAGAGGCTGTGGG - Intergenic
1170224888 20:13981293-13981315 GAGGCTGGGGAGGGGGGTGTGGG + Intronic
1170557297 20:17525175-17525197 GTGGCTGGGAATAAGGCTGTAGG - Intronic
1170589744 20:17762738-17762760 GAGCCTTGGAAGGAGGAGGGAGG - Intergenic
1171884174 20:30639873-30639895 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
1172029232 20:31969659-31969681 GAGGCTTGGAAGGAGGAGGGCGG - Intronic
1173480956 20:43399030-43399052 GAGGCATGGAAGGAGGTTGTGGG - Intergenic
1173578993 20:44132908-44132930 CAGGCGTGGAAGGGGGCGGTGGG - Intronic
1173684312 20:44911876-44911898 GAGACATGGAAGGGGGCTGTGGG - Intronic
1173814273 20:45975143-45975165 AAGGCTTGGAAGAAGGCTCCAGG + Intergenic
1174397986 20:50259767-50259789 GGGGCAGGGAAGGAAGCTGTGGG - Intergenic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1175730279 20:61349658-61349680 GGGGCATGGAAGGGAGCTGTGGG - Intronic
1175930729 20:62492666-62492688 GAGGCCGGGATGGAGGCGGTGGG + Intergenic
1175981656 20:62741682-62741704 GAGCCATGGACAGAGGCTGTGGG + Intronic
1176017694 20:62944450-62944472 GAGGCTTGTGAGGAGGGTGCTGG + Intronic
1176115506 20:63430255-63430277 GAGGCTGGGGAGGAGGCAGCCGG + Intronic
1176449690 21:6851492-6851514 GATGCTTGCTAGGAGGCTGTGGG + Intergenic
1176827862 21:13716516-13716538 GATGCTTGCTAGGAGGCTGTGGG + Intergenic
1176844351 21:13865256-13865278 GGGGGTTGGAAGGTGGATGTGGG - Intergenic
1176847043 21:13884779-13884801 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
1178126014 21:29516418-29516440 CAGTCTTGAAAGGAGGGTGTGGG + Intronic
1178323262 21:31622317-31622339 GAGGCTGTGGATGAGGCTGTGGG - Intergenic
1179514761 21:41898930-41898952 GAGGCTGGGAGGGAGTTTGTAGG + Intronic
1180002725 21:45002375-45002397 GGGGCTTGGGAGGGGGCTGGAGG + Intergenic
1180759288 22:18187355-18187377 GAGGCTTGGCTTGAGGCTGAGGG + Intergenic
1180769596 22:18371651-18371673 GAGGCTTGGCTTGAGGCTGAGGG + Intergenic
1180776732 22:18491015-18491037 GAGGCTTGGCTTGAGGCTGAGGG - Intergenic
1180809459 22:18748381-18748403 GAGGCTTGGCTTGAGGCTGAGGG - Intergenic
1180827536 22:18874614-18874636 GAGGCTTGGCTTGAGGCTGAGGG + Intergenic
1181064132 22:20297716-20297738 GAGGAGAGGAAGGAGGGTGTGGG + Intergenic
1181072380 22:20353367-20353389 GAGGCTTGGCTTGAGGCTGAGGG - Intronic
1181195451 22:21182301-21182323 GAGGCTTGGCTTGAGGCTGAGGG - Intergenic
1181213996 22:21310473-21310495 GAGGCTTGGCTTGAGGCTGAGGG + Intergenic
1181524442 22:23472106-23472128 GAGGCTTGGCTTGAGGCTGAGGG + Intergenic
1181737293 22:24892087-24892109 GAGACCTGGATGGAGGCTGCTGG + Intronic
1183196758 22:36358734-36358756 GAGGCCAGGAGGGAGGCAGTTGG - Intronic
1183511362 22:38237052-38237074 GAGCCTGGGTAGGAAGCTGTAGG + Intronic
1183710654 22:39501529-39501551 CAGGCATGGAGGGAGGCAGTTGG + Intronic
1183786018 22:40029683-40029705 GAGGCCAGGACGGAGGCTGCAGG - Exonic
1184434153 22:44459891-44459913 GAGGCCTGGAAGGAGGGTCCAGG - Intergenic
1184508209 22:44916904-44916926 GAGGCTTGGAAGGCAGCGCTTGG + Intronic
1184674747 22:46035726-46035748 AAGGCTCGGCAGGCGGCTGTGGG - Intergenic
1184685274 22:46094015-46094037 GGGGCCTGGGAGGAGGCTGCAGG - Intronic
1184947079 22:47811161-47811183 GTGCCTTGGAGGGAGGCTGGAGG - Intergenic
1185212157 22:49576422-49576444 GAGACGTGGAGGCAGGCTGTGGG - Intronic
1203231427 22_KI270731v1_random:112838-112860 GAGGCTTGGCTTGAGGCTGAGGG + Intergenic
1203277633 22_KI270734v1_random:100604-100626 GAGGCTTGGCTTGAGGCTGAGGG + Intergenic
950071151 3:10153774-10153796 GAGACTTGGAATGAGGCTGGTGG - Intergenic
950647441 3:14385686-14385708 GAGGAATGGCAGGAGGCTGAAGG - Intergenic
951723095 3:25722756-25722778 GCCGCTTGTAAGGAGGATGTGGG + Intronic
954822831 3:53346864-53346886 GATTCTTGGAAGGAGGGGGTGGG - Intronic
956134703 3:66087302-66087324 AAGCCTTAGAAGGGGGCTGTGGG + Intergenic
956136064 3:66100284-66100306 GAGGCCTGTCAGGGGGCTGTGGG - Intergenic
957085769 3:75675230-75675252 GAGACTGGAAAGGAGGCTGCAGG + Intergenic
957417835 3:79929300-79929322 GTGTCATGGAAGGAGGCTGAGGG + Intergenic
957417846 3:79929370-79929392 GTGTCATGGAAGGAGGCTGAGGG + Intergenic
957864624 3:86005864-86005886 GAGGCTGGGAAGGGTCCTGTCGG - Intronic
959159294 3:102704441-102704463 CAGGCTTGGAAGTCTGCTGTGGG - Intergenic
959856316 3:111162772-111162794 ATGGCTTTCAAGGAGGCTGTTGG - Intronic
959941658 3:112087010-112087032 TAGGCATGGAAGAAGGCTGGGGG - Intronic
960942522 3:122943948-122943970 CAGGCTGGTTAGGAGGCTGTTGG - Intronic
961414996 3:126750669-126750691 GAGGCTTGGGAGAAAGCTCTGGG - Intronic
962828310 3:139118915-139118937 GAGTCGTGGATGGAGGCAGTGGG + Intronic
962941223 3:140126278-140126300 GTGGCTTGGAAGTAGGCAGATGG + Intronic
963103029 3:141623649-141623671 GAGGGGTGGAAGGTGCCTGTTGG + Intergenic
963480138 3:145862265-145862287 GAGGCTGGGAAGGATTGTGTAGG - Intergenic
964507501 3:157415519-157415541 GAGACCTGTTAGGAGGCTGTTGG - Intronic
964697888 3:159530408-159530430 GAGGGTAGGGAGAAGGCTGTTGG - Intronic
966525333 3:180913081-180913103 GAGTCGTGAAAGGAGGCGGTGGG + Intronic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
969100135 4:4762598-4762620 CAGGCTGGGGAGGAGGCTTTGGG - Intergenic
969100333 4:4763665-4763687 GCGGCTAGGAAGGAGGCAGCAGG - Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969127554 4:4963823-4963845 GGGGCTTGGTAGGAGGCAATTGG + Intergenic
969582970 4:8076507-8076529 GGGGCTGGGGATGAGGCTGTAGG - Intronic
971263412 4:25077016-25077038 GAGGGCTGGAAGGAGGTTGGGGG - Intergenic
972111822 4:35571363-35571385 GAGGCTGGCAAGGAGGCAATGGG + Intergenic
973227700 4:47804707-47804729 GAGGCTGGGAAGGATGGTGGGGG + Intronic
973367839 4:49222146-49222168 GGGGGTTGGAAGGGGGATGTAGG - Intergenic
973393215 4:49573280-49573302 GGGGGTTGGAAGGGGGATGTGGG + Intergenic
974038966 4:56841632-56841654 GAGGCTCTGAAGGAGCCTGAGGG + Intergenic
976002297 4:80387169-80387191 GTGCTGTGGAAGGAGGCTGTGGG + Intronic
976109399 4:81654998-81655020 GAGGCTGGGAAGGAGAGTGGGGG - Intronic
980531448 4:134060915-134060937 GAGGCTGGGAAGGATAGTGTGGG + Intergenic
984884717 4:184440228-184440250 GGAGCATGGAAGGAGGCCGTGGG - Intronic
1202764916 4_GL000008v2_random:141639-141661 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
985943165 5:3155226-3155248 GGGGCTGGGAAGGAGACTGTGGG + Intergenic
986345690 5:6833378-6833400 GAGGTTTCTAAGGAGGCTTTGGG - Intergenic
986516806 5:8573088-8573110 GAGGCTGGGAGGGAAGCTGGAGG - Intergenic
986606613 5:9529293-9529315 GCAGCTGGGGAGGAGGCTGTGGG - Intronic
986792353 5:11174138-11174160 GAGGCCTGGCAGGAAGTTGTGGG + Intronic
987000541 5:13655565-13655587 GGGTCATGGAAGGAGGGTGTAGG - Intergenic
987000594 5:13655831-13655853 GGGTCATGGAAGGAGGGTGTAGG - Intergenic
987000610 5:13655894-13655916 GGGTCTTGGAAGGAGGGTGCAGG - Intergenic
987167684 5:15218540-15218562 GAGGCATGGAGGGAGTTTGTTGG + Intergenic
988091280 5:26543736-26543758 GAGACCTGGAAGGAAGCAGTTGG - Intergenic
988850093 5:35172359-35172381 GAGGCTTGGTAGGAGGTTGGAGG + Intronic
989193759 5:38695820-38695842 GAAGCTTCCAAGCAGGCTGTGGG + Intergenic
989272749 5:39552060-39552082 GAGGAAAGGAAGGAGGATGTAGG - Intergenic
989744121 5:44807524-44807546 GAACCAAGGAAGGAGGCTGTGGG - Intergenic
990347553 5:54884493-54884515 GAGGGTTGGGAGGAGGCAGAAGG + Intergenic
991246128 5:64510053-64510075 AAGGCTGGTAGGGAGGCTGTAGG + Intronic
991447730 5:66717897-66717919 GAGGGAAGGAAGGAGGCCGTGGG + Intronic
991510640 5:67373136-67373158 GAGGCTGGGGAGGAGGATGGGGG - Intergenic
991976830 5:72191494-72191516 CAGGTCTGGAAAGAGGCTGTGGG + Intronic
993414415 5:87609004-87609026 GAGGCTTGAGAGAAAGCTGTGGG - Intergenic
993625952 5:90224878-90224900 GAGGAGTGGAAGGACACTGTAGG - Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
996087761 5:119321927-119321949 GAGGCAGGGAAGGAGGGAGTGGG - Intronic
997422306 5:133779217-133779239 CAGGAGTGGAAGGAGGCTGCGGG - Intergenic
998184638 5:139968847-139968869 GAGGCTGGGAGGAAAGCTGTAGG - Intronic
998599880 5:143574797-143574819 GAGACCAGGGAGGAGGCTGTTGG - Intergenic
998824195 5:146084381-146084403 GAGGTTTGAGAGGAGGGTGTTGG + Exonic
999089867 5:148926755-148926777 GAGGCTGGGAAGGTGGTGGTCGG - Intronic
999257341 5:150216894-150216916 CAGGCTTGGGAGGAGGCCATGGG - Intronic
999877992 5:155829577-155829599 CAGGCCTCGAAGGAGGCTGCTGG + Intergenic
1001066409 5:168538246-168538268 GAGGCTCGGCTGGAGGCAGTGGG - Intergenic
1001700696 5:173704812-173704834 GAGGCAATGAAGGAGGCTGGAGG + Intergenic
1001865787 5:175104269-175104291 GAGGCTTGAATGAATGCTGTAGG - Intergenic
1002046507 5:176544258-176544280 GTGCCCTGGAAGGAGGCTCTGGG + Intronic
1002167459 5:177357386-177357408 CATGCATGGAAGGAGCCTGTAGG + Intergenic
1002414880 5:179114978-179115000 GAGGCTGGAAATGAGGTTGTTGG - Intronic
1002468443 5:179420373-179420395 GAGGCTTTCAGGGAGGCTGTGGG + Intergenic
1003051923 6:2788007-2788029 GAGGCTTGGGAGGTGGCAGCAGG - Intergenic
1003965964 6:11252503-11252525 GAGGCATGGGAGGTAGCTGTGGG - Intronic
1004056799 6:12147128-12147150 AAGGCTGGGAAGCAGGCTGGGGG + Intronic
1004206794 6:13598888-13598910 TAGGCTGGGAGGGAGGGTGTAGG + Intronic
1006249424 6:32768731-32768753 GAGGATGGGAAGGAGGGTGAAGG - Intergenic
1006405688 6:33843556-33843578 GAGGCTTGGGAGGAGGCTGGGGG - Intergenic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1007364482 6:41381757-41381779 GAGGCTGGGCAGGAGGTTGTAGG + Intergenic
1007709286 6:43811567-43811589 GAGGCTTGGAGGCTGGCTGGGGG + Intergenic
1007724551 6:43907181-43907203 GGGGCTCTGAGGGAGGCTGTGGG - Intergenic
1008030117 6:46686107-46686129 GAGCCATGGAAGGAGGTTGGAGG + Intergenic
1008249715 6:49225211-49225233 GAGGCTAGCAAGGGGGCTGTGGG - Intergenic
1008488401 6:52059547-52059569 GAGGCTTGGAAAGATTGTGTGGG - Intronic
1009822441 6:68820644-68820666 GAGGCTGGGAAGGACGGTGGAGG - Intronic
1009968612 6:70603711-70603733 GAGGCTTGGTAGGAGGTAATTGG + Intergenic
1011847330 6:91582338-91582360 GAGGATTGGAAGGATGCAGAAGG - Intergenic
1012986343 6:105880389-105880411 CAGGCTGGGAAGGTGGCTGAGGG - Intergenic
1013036865 6:106393433-106393455 GAGTCTGGGAAGCCGGCTGTAGG - Intergenic
1013777355 6:113693239-113693261 GAGGCCTGGAAAGAGTGTGTTGG - Intergenic
1014562556 6:122908661-122908683 GAGTCCTGGATGGAGGCTGCAGG - Intergenic
1014743454 6:125172021-125172043 GAGGGAGGGAAGGAGGCAGTAGG - Intronic
1017051262 6:150395871-150395893 GAGGCTTGGAAAGAGGTCGATGG + Intronic
1017713180 6:157187867-157187889 GATGTTTCCAAGGAGGCTGTCGG + Intronic
1017789025 6:157779375-157779397 GAGCCTTGGCAAGACGCTGTTGG + Intronic
1017815353 6:158012246-158012268 CAGCCTGGGAAGGAGGATGTGGG - Intronic
1018901693 6:168054803-168054825 GTGACGTGGAAGGGGGCTGTGGG + Intergenic
1019160989 6:170066698-170066720 GAGGCTTGGAAGTGGGCAGTGGG - Intergenic
1019232629 6:170581037-170581059 GAGACTTGGCAGGAGGCAGTAGG - Intronic
1020329588 7:7003940-7003962 GAGGCTTGGTTGCAGGCTATGGG + Intergenic
1021746970 7:23751026-23751048 GAGGCTAGGAAGGATGTGGTAGG - Intronic
1022239027 7:28490987-28491009 GAGGCCTGGGCAGAGGCTGTTGG + Intronic
1023843212 7:44108002-44108024 GAGGCTTCACAGGAGGCTCTGGG - Exonic
1024324220 7:48096071-48096093 GAGGCCTAGTAGGAGGCTGGTGG + Intronic
1025078735 7:55964677-55964699 GAGCCTGGGCAGGAGGCTGCAGG - Exonic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1028821201 7:95214053-95214075 GTGGCTTGGAAACAGGCAGTGGG - Intronic
1028828991 7:95305999-95306021 GAGGGATGGAAGGAGGATCTGGG + Intronic
1029450915 7:100641407-100641429 GGGGCTTGGGAGGGGGCTGAGGG + Intronic
1032100839 7:128975843-128975865 ATGGCATGGAAGAAGGCTGTCGG - Exonic
1032251769 7:130263765-130263787 AAGCCTTCGAAGGAGGTTGTAGG - Intergenic
1032467330 7:132154171-132154193 CGGGCTGAGAAGGAGGCTGTAGG + Intronic
1032508841 7:132455889-132455911 GAGGCCTGGGAGGAAGATGTGGG + Intronic
1033288234 7:140060796-140060818 GAGGCCTGAAAAGAGGCTGAGGG - Intronic
1033584237 7:142762424-142762446 GAGGCTGGGAAGGAGGGTTAAGG + Intronic
1034204058 7:149300225-149300247 GGGGCTTTGAAAGAGGCTCTTGG - Intergenic
1034439618 7:151080067-151080089 AAGGCGTGGAAGGAGGCAGAGGG - Intronic
1034746872 7:153530521-153530543 GAGCCTGGGACGGAGGCTGGAGG + Intergenic
1035611670 8:969736-969758 GTGGCTTGGAGGGAGCCTGGTGG + Intergenic
1035908061 8:3535533-3535555 GAGACTTGGAAGGGGGCTGGTGG + Intronic
1036482340 8:9150518-9150540 GAGGCTTGTAGGGAGGTTGGGGG - Intronic
1037624296 8:20593919-20593941 GAGGGTTGGAAGGGGGGGGTTGG + Intergenic
1037759771 8:21734089-21734111 CAGGCTTGGAAGGAAGGGGTTGG - Intronic
1038919030 8:32061747-32061769 GAGGCATAGTAGGAAGCTGTTGG + Intronic
1040459870 8:47636952-47636974 GAGCCTTGGCAGGAGGGTGAGGG + Intronic
1040559984 8:48515083-48515105 GAGGCTCGGGAGGAGGGTTTTGG + Intergenic
1040696202 8:50001975-50001997 CAGGCTGGGAAGGAGGTTTTGGG + Intronic
1040744338 8:50621651-50621673 GAGGCTTGGCAGTTGTCTGTTGG - Intronic
1041137429 8:54775202-54775224 AAGTCTGGGAAGGAGGATGTGGG + Intergenic
1042174635 8:66027038-66027060 GTGGCTTGAAAGGAGGATGAGGG - Intronic
1042706670 8:71670636-71670658 GAGGCTTGGCATGAGGACGTGGG - Intergenic
1044623742 8:94216436-94216458 GAGGCCTGGGAGGAGGCCGGCGG + Intronic
1046857332 8:119048135-119048157 GAGGCGGGGAAGGAGGAAGTGGG - Intronic
1047389661 8:124439892-124439914 GAGGCTGAGAAGGAGCCTGGCGG + Intergenic
1048936608 8:139362783-139362805 AGGGCTTTGGAGGAGGCTGTGGG - Intergenic
1049245279 8:141559117-141559139 GAGCATCGGATGGAGGCTGTGGG + Intergenic
1049633448 8:143672424-143672446 GAGGGTTGGAGGGAGGGAGTGGG - Intergenic
1049848396 8:144816763-144816785 GAGGCTAGGAAGGATGGGGTGGG + Intergenic
1050092572 9:2029872-2029894 GAGGCTTGGATTGTTGCTGTGGG + Intronic
1050353607 9:4762949-4762971 AAGCCGTGGAAGGAGGCTGGTGG + Intergenic
1052028435 9:23601118-23601140 GAAGCTGGGAAGGAGGCTTGAGG - Intergenic
1053071879 9:35106625-35106647 GAGGCTTCGAAGGGGGCTCCTGG + Exonic
1054956093 9:70911990-70912012 AGGGCCTGGAAGGAGGCAGTTGG + Intronic
1055553849 9:77455894-77455916 GAGGCTGGGCAGGGGCCTGTGGG - Intronic
1056303141 9:85262460-85262482 GGGGCTTGGCAGGAAGCTGTGGG - Intergenic
1056397907 9:86198164-86198186 GAGGCTTGGAGGGAGGTGTTTGG + Intergenic
1057209042 9:93189658-93189680 GCGGCTGGGAGAGAGGCTGTCGG - Intronic
1057561817 9:96133745-96133767 GTGTCCTGGTAGGAGGCTGTTGG - Intergenic
1057593612 9:96395310-96395332 GAGGCCGGCCAGGAGGCTGTCGG - Intronic
1057717418 9:97505519-97505541 GAGTCTATGAAGGAGGCTGAAGG - Intronic
1059243211 9:112826317-112826339 GAGGGTTGGCAGAAGGCTGGGGG + Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1062059861 9:134489392-134489414 GAGCCCTGGTTGGAGGCTGTTGG + Intergenic
1062109528 9:134774306-134774328 GGGGCTGGGAGGGAGGCGGTGGG + Intronic
1062569532 9:137178768-137178790 GAGGCCTGGAGGGAGGCAGCAGG + Intronic
1203791526 EBV:154186-154208 GAGGCAGGGAAAGAGGCCGTTGG + Intergenic
1203519495 Un_GL000213v1:33025-33047 GATGCTTGCTAGGAGGCTGTGGG - Intergenic
1203545666 Un_KI270743v1:126527-126549 GGGGGTTGGAAGGGGGATGTGGG - Intergenic
1185731761 X:2467397-2467419 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1185732539 X:2473097-2473119 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1185733141 X:2477319-2477341 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1186485223 X:9929453-9929475 GAAGATGGGAAGGAGCCTGTGGG + Intronic
1187465691 X:19525731-19525753 GAGGCTTGTTAGCATGCTGTTGG + Intergenic
1187793100 X:22972130-22972152 GAGGCTGGGAAGGACAGTGTGGG + Intergenic
1188784236 X:34324477-34324499 GAAGGTTGGAAGGAGGGTGAGGG + Intergenic
1190199065 X:48344865-48344887 GGTGCCTGGAAGGAGGTTGTGGG - Intergenic
1190204900 X:48394792-48394814 GGTGCCTGGAAGGAGGTTGTGGG + Intergenic
1190205636 X:48400611-48400633 GGTGCCTGGAAGGAGGTTGTGGG - Intergenic
1190282389 X:48939637-48939659 GAGGCCAGGAAGGAGGTTGGTGG - Intronic
1190322852 X:49188633-49188655 GGGGCTTGGAAGGGCGCTGAGGG - Exonic
1190417787 X:50198415-50198437 GAGGCTGGGGAGGAGCCTGAGGG - Intronic
1190658720 X:52635359-52635381 GATGCCAGGAAGGAGGTTGTGGG + Intergenic
1190677129 X:52791845-52791867 GATGCCAGGAAGGAGGTTGTGGG + Intergenic
1192078140 X:68021123-68021145 GAGACTTGAAAGGAAGCTTTAGG - Intergenic
1192205870 X:69095559-69095581 GAGGCCTGGCAGGTGGCAGTTGG + Intergenic
1192232192 X:69273115-69273137 GGGGGTTTGAAGGAGGCTGAGGG - Intergenic
1192343461 X:70282239-70282261 GAGGCCTGGATGGAGGCCGGAGG + Exonic
1192655328 X:72987399-72987421 GTGGATTGGAAGGAAGTTGTTGG - Intergenic
1193486913 X:82096528-82096550 GAAGCTTTGTAGGAGGCTGGAGG - Intergenic
1194872753 X:99153326-99153348 AAACCTTGGAAGGAGTCTGTGGG - Intergenic
1195449499 X:104994961-104994983 GAGCCATGGAAGCAGGCTGGGGG + Intronic
1196324700 X:114389453-114389475 ATGGCATGGAAGAAGGCTGTGGG + Intergenic
1197354859 X:125425895-125425917 GAGGCTGGGAAGGATGGTGGGGG + Intergenic
1197717545 X:129720205-129720227 GAGGCTGAAAAGGAGGATGTGGG - Intergenic
1198378361 X:136061447-136061469 AATGCTAGGCAGGAGGCTGTGGG - Intergenic
1198431656 X:136573090-136573112 GTGGCTTGAAAGGAGGCCTTGGG + Intergenic
1199063983 X:143391934-143391956 GAAGGTTGGAAGGGGGCTGTAGG - Intergenic
1199717758 X:150518463-150518485 GAGGAATAGAAGGAGGCTGGTGG + Intergenic
1199730700 X:150629354-150629376 GGGGCTTGGAGGGACGTTGTTGG - Intronic
1200116083 X:153770269-153770291 GGGGCTGGGATGGAGGCTGGAGG + Intronic