ID: 1152683928

View in Genome Browser
Species Human (GRCh38)
Location 17:81684362-81684384
Sequence CCGAATGCCCGGGCCCGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152683928_1152683938 16 Left 1152683928 17:81684362-81684384 CCTCCGCGGGCCCGGGCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1152683938 17:81684401-81684423 CGACGAGCACCCGGCCGAGTGGG 0: 1
1: 0
2: 0
3: 4
4: 26
1152683928_1152683935 7 Left 1152683928 17:81684362-81684384 CCTCCGCGGGCCCGGGCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1152683935 17:81684392-81684414 CCTCTTGACCGACGAGCACCCGG 0: 1
1: 0
2: 0
3: 1
4: 32
1152683928_1152683937 15 Left 1152683928 17:81684362-81684384 CCTCCGCGGGCCCGGGCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1152683937 17:81684400-81684422 CCGACGAGCACCCGGCCGAGTGG 0: 1
1: 0
2: 0
3: 2
4: 68
1152683928_1152683939 24 Left 1152683928 17:81684362-81684384 CCTCCGCGGGCCCGGGCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1152683939 17:81684409-81684431 ACCCGGCCGAGTGGGCCACAAGG 0: 1
1: 0
2: 1
3: 2
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152683928 Original CRISPR CCGAATGCCCGGGCCCGCGG AGG (reversed) Intronic
900556852 1:3284959-3284981 CCGAAAGCCCGGGCCCAGAGGGG - Intronic
901685353 1:10940645-10940667 CCGAATGCCCAGGGCCAGGGAGG - Intergenic
902585740 1:17437965-17437987 GCGCGCGCCCGGGCCCGCGGCGG - Intronic
1063665148 10:8056244-8056266 CAGAGAGCCCGGACCCGCGGAGG - Intronic
1064553018 10:16521317-16521339 CCGAAGTCCCGAGCCCGGGGTGG + Exonic
1072520688 10:96227380-96227402 CCGAGTGCCCAGGTCTGCGGGGG + Intronic
1075380345 10:122013674-122013696 CCGACTGCCCGAGCCCTCTGTGG + Intronic
1077414073 11:2416389-2416411 CCAAATGCCCTTGCCCGTGGAGG - Intronic
1078390321 11:10931271-10931293 CCGACTGCCGGAGCCCGTGGTGG + Intergenic
1083713202 11:64561150-64561172 CCGAGTGCCCTGGGCTGCGGTGG - Intronic
1083883062 11:65557941-65557963 CCGGATGCCCGGGCCCCGAGGGG - Exonic
1084524214 11:69685926-69685948 CCGAGTCCCCGGCCCCGCGCGGG + Intergenic
1084527067 11:69704179-69704201 CTGCCTGCCCGGGCCCGGGGAGG - Exonic
1085016679 11:73178424-73178446 CAGAAAGCCCGGGGCCGAGGAGG + Intergenic
1088315027 11:108498449-108498471 CCGAAAGACCCGCCCCGCGGTGG - Intergenic
1094841475 12:34344327-34344349 CGGAGTGGCTGGGCCCGCGGGGG - Intergenic
1096491369 12:52014915-52014937 CCGAAGGCGCGGGCCGGGGGCGG - Exonic
1103595461 12:122022292-122022314 CCAAGTCCCGGGGCCCGCGGCGG - Intronic
1121342247 14:93112381-93112403 CCGAATGGTCCGGCCCGGGGTGG - Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132779372 16:1614368-1614390 CCAGACGCCCGGGCCGGCGGCGG - Intronic
1132885411 16:2180115-2180137 CCGACTCCCCAGGCCCCCGGCGG + Exonic
1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG + Intronic
1141608790 16:85170001-85170023 CCGGCTGCGCGGGGCCGCGGAGG + Intergenic
1141961910 16:87414435-87414457 CCGACTGCACGGGCCCGACGTGG + Exonic
1142132614 16:88437851-88437873 CAGAAGGCCCGGGCCCTCGAGGG + Exonic
1148816547 17:50332067-50332089 CAGAATGCCCAGGGCCCCGGGGG - Intergenic
1150267870 17:63842564-63842586 CAGCATGCCGGGTCCCGCGGGGG + Exonic
1152683928 17:81684362-81684384 CCGAATGCCCGGGCCCGCGGAGG - Intronic
1152717873 17:81908537-81908559 CTGGATGGCCAGGCCCGCGGTGG + Intronic
1153900661 18:9614628-9614650 CCGAGGGCCCGGGCCTGCCGCGG + Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1160499735 18:79395802-79395824 CCTGCTGCCCGGGCCCGCGCGGG - Intergenic
1160790465 19:920592-920614 CCGAGGGTCCGGGCCGGCGGGGG - Exonic
1161073332 19:2273111-2273133 CCGGATGCCCAGCCCCGAGGCGG - Exonic
1164658661 19:29942752-29942774 CCAGCTGCCCGGGCCCCCGGAGG + Intronic
1165080231 19:33302529-33302551 GCGAATGGCCCGGCCCGCGCCGG + Exonic
1166956368 19:46468151-46468173 CCAAATGCCAGGGCCTGCAGAGG + Exonic
1167643623 19:50694843-50694865 CGGCAGGCCCCGGCCCGCGGTGG - Intronic
927859304 2:26550620-26550642 CCAAATCCCTGGGTCCGCGGTGG + Intronic
932087470 2:68774938-68774960 CAGAATGACGGGGCCCGCCGCGG + Intronic
937203679 2:120222782-120222804 CCAAACGCCCGCGCCCACGGAGG + Exonic
944766553 2:202871025-202871047 CAGAATGCACGGGCCCGCGAGGG - Intronic
1174204478 20:48828493-48828515 CTGACTTCCCGGGGCCGCGGAGG - Intergenic
1174400570 20:50273738-50273760 CAGAGTGCCCGGGGCCGGGGGGG - Intergenic
1177225368 21:18245783-18245805 CCGAATGCCCAGGCATCCGGAGG - Intronic
1178948307 21:36966350-36966372 CCGAACTCCCGGGCTCCCGGCGG + Intronic
1179584476 21:42365947-42365969 CCGAATGCCCGTCCCAGTGGTGG - Intronic
1181006532 22:20016353-20016375 CCGAGACCCCGGGCCGGCGGGGG - Intronic
1183601646 22:38843688-38843710 CCGCGTCCCCGGGCCCGCAGCGG - Exonic
954156248 3:48686303-48686325 CCGAGAGCCGGGCCCCGCGGGGG - Intronic
955567683 3:60266372-60266394 CATAATGCCCAGGGCCGCGGAGG + Intronic
966596239 3:181726669-181726691 CTGAAAGGCAGGGCCCGCGGCGG - Intergenic
966743486 3:183254357-183254379 CGGGCTGCCGGGGCCCGCGGTGG - Intronic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
969032594 4:4226727-4226749 CGGAATCCCCGGCCCCCCGGCGG - Exonic
973279141 4:48341450-48341472 CCGACTGGGCCGGCCCGCGGGGG + Exonic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
997301993 5:132813376-132813398 CCGAAGGCCGGGGCCCGGCGGGG + Intergenic
1006408538 6:33858737-33858759 CCGCATGCCCGGCACCGCTGGGG - Intergenic
1006860839 6:37170671-37170693 CCGCATCCCCGGGCCGGAGGCGG - Intronic
1017811647 6:157988154-157988176 CCCAACGCCCGGGCCTGGGGTGG - Intronic
1019353861 7:568922-568944 TGGAAAGCCGGGGCCCGCGGGGG + Intronic
1020278078 7:6636872-6636894 CCAGATCCCCGGGCCCGCGCGGG - Intergenic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1027138188 7:75639181-75639203 CCGCCTGCCCCGGTCCGCGGGGG - Intronic
1027773961 7:82443138-82443160 CCCAGTGCCCGGCCCCGTGGAGG + Intronic
1034440544 7:151083527-151083549 CACAATGCCCCGGGCCGCGGCGG - Intronic
1037977668 8:23224850-23224872 CCCAGTGCCCGGGCCCGGGCAGG - Exonic
1038554120 8:28494558-28494580 GCGGGGGCCCGGGCCCGCGGTGG + Intronic
1049198320 8:141327409-141327431 CTGAAGGCCGGGGCCCTCGGGGG + Intergenic
1049643632 8:143726604-143726626 CCCGAAGGCCGGGCCCGCGGAGG - Exonic
1051171493 9:14322454-14322476 CGGATTGGCCTGGCCCGCGGCGG + Intronic
1052996003 9:34551912-34551934 CGGCAGGCCCGGGCCCGCCGGGG + Exonic
1057130740 9:92652895-92652917 CAGAATGGCTGGGCCCACGGTGG + Intronic
1061207750 9:129174420-129174442 CAGAATGCGGGGGTCCGCGGAGG - Intergenic
1062319921 9:135985901-135985923 CCGAGTGCCCAGGCCAGCTGGGG - Intergenic
1062626012 9:137441743-137441765 CCGAAGGTCCAGGCCCGGGGCGG + Intronic
1187281277 X:17860449-17860471 CCCAATGCCCAGCCCCGGGGTGG - Intronic
1196684072 X:118495894-118495916 CTCACTGCCCCGGCCCGCGGCGG - Exonic