ID: 1152684443

View in Genome Browser
Species Human (GRCh38)
Location 17:81687196-81687218
Sequence GAAAATGTGCAGGTGCAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152684437_1152684443 24 Left 1152684437 17:81687149-81687171 CCGGGTGTTTACTGGGCACTGAT 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1152684443 17:81687196-81687218 GAAAATGTGCAGGTGCAGATCGG 0: 1
1: 0
2: 0
3: 26
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152684443 Original CRISPR GAAAATGTGCAGGTGCAGAT CGG Intronic
900150375 1:1176326-1176348 GACACTGTGCAGGTGGAGAGAGG + Intronic
900761658 1:4476479-4476501 GGAAATGTGCATGAACAGATGGG - Intergenic
900781135 1:4617733-4617755 GAAAGTGTGCTGCTCCAGATGGG - Intergenic
900975031 1:6011501-6011523 GCAGATGTGCAGGGGCAGAGGGG + Intronic
901617913 1:10556398-10556420 GAAAAAGAACACGTGCAGATAGG - Intronic
902172754 1:14626462-14626484 GAGAAAGTGGAGGTCCAGATGGG + Intronic
902276298 1:15342461-15342483 GAAAATGTGGATCTGCAGACTGG - Intronic
904194996 1:28778603-28778625 TAAACTGTACAGGTGCAGGTAGG - Intergenic
905007233 1:34719633-34719655 TAAAATCTGGAGGTGCAAATGGG - Intronic
905108846 1:35579819-35579841 AAAAATGTGCAGATGGAGTTTGG + Intronic
906414934 1:45614105-45614127 GAAAATGAGGAGGAGGAGATTGG + Exonic
907570201 1:55476386-55476408 GGAAGTGTGCAGGTGAAGCTGGG + Intergenic
908847822 1:68342876-68342898 GAAAAGATGAAGGTGCAGATGGG + Intergenic
912383613 1:109260622-109260644 GTAAATGTGCACAAGCAGATGGG - Intronic
912769849 1:112453411-112453433 GAATATTTGCAGTTGTAGATGGG + Intronic
913013395 1:114708406-114708428 GAAAATGTGCAGAAGAGGATAGG + Intronic
914391455 1:147226703-147226725 CAAGATTAGCAGGTGCAGATTGG - Intronic
914854899 1:151343702-151343724 GCACATGGGCATGTGCAGATCGG + Exonic
918792598 1:188849008-188849030 GAAAATGTTCAGGCACATATAGG - Intergenic
919266671 1:195275873-195275895 CACATTGTGAAGGTGCAGATGGG - Intergenic
919786301 1:201260406-201260428 AAAAATGTGCACACGCAGATGGG + Intergenic
1062772093 10:110145-110167 GCTACTGTGCAGGTCCAGATAGG + Intergenic
1062800480 10:375795-375817 GAAGCTGTGCAGGTGCAGTGTGG - Intronic
1063642485 10:7844201-7844223 GAAAATCTACAGTTTCAGATAGG - Intronic
1065294966 10:24265621-24265643 GAAAATGTCCACATGAAGATGGG - Intronic
1066207658 10:33205556-33205578 GAAAAGGGGCAGGTGCTCATTGG + Intronic
1066801027 10:39190781-39190803 CAAAATGTCCAGTTGCAGAATGG + Intergenic
1069163311 10:65117128-65117150 GATAATGTGCAAGAACAGATGGG - Intergenic
1069656526 10:70093469-70093491 GACAATGTGCTGGTGCACAGGGG + Intronic
1072309429 10:94139961-94139983 CCAATTCTGCAGGTGCAGATTGG + Intronic
1073011851 10:100366341-100366363 GAAACTGTGCAGTTACAGAATGG - Intergenic
1076001877 10:126918930-126918952 GAGAAAGTCAAGGTGCAGATGGG + Intronic
1076435370 10:130437610-130437632 GAAGATGTGCAGTTGAAGATGGG - Intergenic
1077382746 11:2252400-2252422 GAAAATATGCAAGCTCAGATAGG + Intergenic
1078648135 11:13161310-13161332 AAAAATGTGCAAATGCATATAGG - Intergenic
1082308995 11:50622085-50622107 CAAAATGTACATTTGCAGATTGG + Intergenic
1082553263 11:54527612-54527634 TAAAATCTGCAGGTGGACATTGG + Intergenic
1082589054 11:54982622-54982644 CCAAATGTGCATTTGCAGATCGG - Intergenic
1082594516 11:55059890-55059912 CAAAATGTCCATGTGCAGAATGG - Intergenic
1083525574 11:63361491-63361513 GAAGATGTGCAGGGGATGATGGG + Intronic
1084101397 11:66951941-66951963 TAAAATGTGCAGGGGAAGAAGGG + Intronic
1084489821 11:69472145-69472167 GGGAATGGGCAGGTGCAGGTGGG + Intergenic
1084676801 11:70640028-70640050 CAGAACGTGCAGGTGCAGCTGGG + Intronic
1086241205 11:84694142-84694164 GAAAATTAGCAGGTGGAGAAGGG + Intronic
1086899057 11:92345695-92345717 TAAAACTTGTAGGTGCAGATGGG + Intergenic
1087578577 11:100023414-100023436 GAGAATGTGTAGGGGCAGACAGG - Intronic
1088214034 11:107488171-107488193 GAAAATGTGCACTTGTAAATTGG - Intergenic
1090402830 11:126460000-126460022 GAAAATGAGCAGGTTCACAAAGG + Intronic
1093641352 12:21529943-21529965 GAAAATGTGCAGAGCCAGAAAGG + Intronic
1093947323 12:25124554-25124576 GAAAATGTGTGGGTGAAGACAGG + Intronic
1093999085 12:25675055-25675077 GAAAATGTGGAAATACAGATGGG + Intergenic
1094776568 12:33736161-33736183 GAAAATATGCATGATCAGATGGG - Intergenic
1096977862 12:55709729-55709751 CAGAAGCTGCAGGTGCAGATAGG - Intronic
1098390591 12:69965933-69965955 GAATATGTGCAGGTTCATCTAGG - Intergenic
1098430363 12:70412719-70412741 GAAAATGTGCATATAAAGATGGG + Intronic
1100105032 12:91159897-91159919 GAAAATGTGGAGGGGCAAAAGGG + Intronic
1101468321 12:104970732-104970754 GAAAATGTGCACAGGCAGGTGGG - Intergenic
1102212341 12:111136503-111136525 GAAAAATTGCAGGTGCAGCAGGG + Intronic
1103049376 12:117766613-117766635 GAAAAAGTGCAGGAGCATACAGG + Intronic
1105422496 13:20265345-20265367 GAAAATTTGAAGCTGCAGTTAGG + Intergenic
1107024532 13:35786075-35786097 AATAATGGGCAGGAGCAGATGGG - Intronic
1107608555 13:42088305-42088327 GAAAATTTGCAAGTTCAGAGAGG + Intronic
1108105787 13:47007387-47007409 AAAGATGGGCAGGTGCAGGTAGG + Intergenic
1113190078 13:107735018-107735040 GAAAAAATGGAGTTGCAGATTGG + Intronic
1113499354 13:110760983-110761005 GAAAATGTGCAGGCTGAGATTGG + Intergenic
1113513477 13:110873328-110873350 GGAAATGGGCAGGGGGAGATGGG - Intergenic
1114208051 14:20591647-20591669 GAAAAGGTTAAGGTGGAGATGGG + Intronic
1116070205 14:40034226-40034248 GAAAATGTGAAGATTCAGACAGG - Intergenic
1118659657 14:67994735-67994757 GAAAATCATCAGTTGCAGATGGG - Intronic
1119627531 14:76192582-76192604 AAAGCTGTGCAGCTGCAGATAGG + Intronic
1119633440 14:76254334-76254356 GAAAAACTGCAGCTGCAGCTGGG + Intronic
1121486596 14:94321249-94321271 AAAAAGATGCAGCTGCAGATGGG - Intronic
1127662334 15:61112023-61112045 GTAACTGTGCCAGTGCAGATGGG + Intronic
1127901183 15:63342086-63342108 GACAATGTGCAGCTGCAGTGGGG + Exonic
1129614199 15:77084841-77084863 GAAAAAGTGCAGGCCCAGAGAGG - Intergenic
1130151278 15:81313552-81313574 GAAAATCAGCAGGTCCAGAGAGG - Intronic
1130707336 15:86245767-86245789 GAAAATGTTCAGGTAAAGTTCGG - Intronic
1131279628 15:91010175-91010197 GAAATTGTGGAGGAGCAGATGGG + Intronic
1131306992 15:91253705-91253727 GAGAATGGGCAGTTGTAGATTGG + Intronic
1132571497 16:646367-646389 TAAAACGTGCAGGTGGAGATGGG - Intronic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1133700688 16:8305606-8305628 TATAATGTGCATGTGGAGATGGG + Intergenic
1133882541 16:9796594-9796616 TGAAATGTGCATGTGCAGCTAGG + Intronic
1134142434 16:11732663-11732685 GAAAATGTGGGGGTAGAGATGGG + Intronic
1136739984 16:32510397-32510419 GAAAATGTCCATTTGCAGAATGG + Intergenic
1137852423 16:51759444-51759466 CAAAATGTCTGGGTGCAGATAGG + Intergenic
1139523528 16:67499165-67499187 GAAAATGAGCAGGGCCAGGTTGG - Intergenic
1141872151 16:86794450-86794472 GTGAAGGTGCAGGTCCAGATGGG + Intergenic
1203012925 16_KI270728v1_random:316940-316962 GAAAATGTCCATTTGCAGAATGG - Intergenic
1203031260 16_KI270728v1_random:590099-590121 GAAAATGTCCATTTGCAGAATGG - Intergenic
1203040461 16_KI270728v1_random:744332-744354 GAAAATGTCCATTTGCAGAATGG + Intergenic
1142609259 17:1099370-1099392 GTAAATGTGCAGGTGCAGGCCGG - Intronic
1142678000 17:1527201-1527223 GAAAATGTGTATGTGAAAATAGG + Intronic
1143241338 17:5445454-5445476 GCAAATGTGAAGGCACAGATAGG - Intronic
1143774166 17:9186751-9186773 GAAAAAGTGGAGGTGCCGAGAGG - Intronic
1144103436 17:11964195-11964217 GCAAATGTTCAGGTGGAGAGAGG - Intronic
1145108059 17:20136707-20136729 GAAAATGCGCACGTGCAGAATGG - Intronic
1145160970 17:20573396-20573418 GAGAGTGTGCTGGAGCAGATGGG + Intergenic
1145279643 17:21458052-21458074 GAAACTGGGCAGGTGCAGAGAGG + Intergenic
1145398235 17:22512430-22512452 GAAACTGGGCAGGTGCAGAGAGG - Intergenic
1145683227 17:26623850-26623872 GAGAATCTGCAAGTGGAGATTGG + Intergenic
1147182789 17:38697181-38697203 GAGACTGTGCAGGTGCAGAGTGG - Intergenic
1149015393 17:51903290-51903312 GAGAGTTTGCAGGTGCTGATTGG + Intronic
1152212657 17:79010525-79010547 GGAAAGCTGAAGGTGCAGATGGG - Intergenic
1152253113 17:79221900-79221922 GGAAGGGTGGAGGTGCAGATGGG + Intronic
1152684443 17:81687196-81687218 GAAAATGTGCAGGTGCAGATCGG + Intronic
1153976725 18:10274719-10274741 GAAAATGTCCATGAGCACATTGG + Intergenic
1155960921 18:31994057-31994079 GAAAATGTGCTGGGGAACATTGG + Intergenic
1156306493 18:35882931-35882953 GGCAATGTCCAGGTGCAGCTGGG - Intergenic
1156584477 18:38416436-38416458 GTAGATGAGCAGGTGCAGTTTGG - Intergenic
1157478545 18:48038271-48038293 GAGAATCTGCAGGAGCAGAGGGG - Intronic
1159462755 18:68741491-68741513 GAAACTGTGAATGTGCTGATGGG + Intronic
1160331108 18:77992356-77992378 GAGAAAGTGGAGGTGTAGATGGG + Intergenic
1162530362 19:11232414-11232436 AAAAATGTGCACGTGTATATAGG + Intronic
1164303666 19:23984423-23984445 GGAAATGTGCATTTGCTGATTGG - Intergenic
1164765840 19:30767821-30767843 GAAAACATGCAAGAGCAGATGGG - Intergenic
1164797052 19:31041731-31041753 GAGTATGTGCAGGTGCAGGCTGG - Intergenic
1164818485 19:31225597-31225619 GAGGATGGGGAGGTGCAGATGGG - Intergenic
1164913008 19:32027464-32027486 GAACAGGTGCAGGTGGAGATCGG - Intergenic
1165667809 19:37648762-37648784 GCAAAACTGCAGGTGCACATTGG + Intronic
1166623245 19:44324444-44324466 GATAATATGCATGAGCAGATAGG - Intergenic
1166917750 19:46207171-46207193 GAACATGTGGAGGTGCTGAGAGG - Intergenic
1167453322 19:49584976-49584998 CAAAATGGGCAGGTGAGGATGGG - Intronic
1167983630 19:53297287-53297309 GGAAATGCGCGGGTGTAGATGGG - Intergenic
925088923 2:1137289-1137311 GTGTGTGTGCAGGTGCAGATGGG - Intronic
925126161 2:1458671-1458693 GAAAAAGTGCAGGTACACATGGG - Intronic
925709047 2:6719962-6719984 CAAATTTTCCAGGTGCAGATGGG + Intergenic
927712247 2:25333083-25333105 GAAGAAGTGGAGGTGCAGAAAGG + Intronic
929994370 2:46816272-46816294 GAAGGTGTGCAGGTGCGGAAAGG + Intergenic
933431758 2:82190384-82190406 GAAAAAGTGCAGGCACAGACTGG - Intergenic
935635649 2:105247925-105247947 GAAAAGGTCTAGGTTCAGATGGG - Intergenic
935867043 2:107400030-107400052 ATAAACGTGAAGGTGCAGATAGG + Intergenic
937638508 2:124185169-124185191 GAAAATGTGGAGTTTCAGCTTGG - Intronic
938369415 2:130760037-130760059 GAAAGTCTGCAGGTGCAGGGTGG + Intronic
938948369 2:136234987-136235009 GAAAATGTGCAGCCGCGAATGGG + Intergenic
940601897 2:155873696-155873718 GAAAATGTGCAGCTGCCTACAGG - Intergenic
940607635 2:155947318-155947340 GAAAATCTGCTGGTGTAGATCGG + Intergenic
942161529 2:173193704-173193726 GAAAATGTGCAGCTCCAGAAAGG - Intronic
943666569 2:190615492-190615514 GAATATGTGGAGGTGCAGGGAGG - Intergenic
943714197 2:191132607-191132629 GAAAATTGGCAGGTGGGGATGGG + Intronic
944209243 2:197189190-197189212 AAAAATGTCAAGGTGCAGAATGG + Intronic
1169108249 20:3015732-3015754 GAAAATGTGCAGGTACTTAACGG - Intronic
1170031200 20:11946180-11946202 GAAAATGTGTAGGTTCACAAAGG + Intergenic
1170199294 20:13725151-13725173 GATAATCTGCATGAGCAGATAGG - Intronic
1170736488 20:19017652-19017674 GAGAAGCTTCAGGTGCAGATGGG - Intergenic
1171997864 20:31746709-31746731 CAAAAGGTGCAGGTTCAGACCGG - Intronic
1172160100 20:32861882-32861904 GAATATATGCATGTGCATATTGG - Intronic
1172320170 20:33990314-33990336 GAACATGTGGAGGTGGAGACAGG + Intergenic
1173168547 20:40703810-40703832 GAAAATGTCCTGGGGCAGAAAGG + Intergenic
1175064063 20:56270335-56270357 GACAGTGGGCAGGTGCAGAGTGG + Intergenic
1175610687 20:60348775-60348797 TAAAATGTGCTGTTACAGATTGG + Intergenic
1175807611 20:61838443-61838465 GAGAAGCTGCAGGTGCAAATGGG + Intronic
1176986676 21:15445415-15445437 GACAATGAGCAGGTGCAGGCAGG - Intergenic
1176996518 21:15561318-15561340 GAACATGTGGAGGTGCTGAGAGG - Intergenic
1177450497 21:21259128-21259150 GAAAATGAGGATGTGCAGCTTGG + Intronic
1182969314 22:34557592-34557614 GAAAAGATGAAGGTGGAGATCGG - Intergenic
1183410967 22:37655028-37655050 GAAAATGTGACGGAGCAGCTGGG + Intronic
949520621 3:4850306-4850328 GAGCATGTGCAGGTGCACACTGG + Intronic
952610523 3:35203411-35203433 GAGAAGGTGGAGGTGGAGATTGG + Intergenic
955754947 3:62217191-62217213 GAAAATGGGCAGGCACAGCTAGG + Intronic
956165352 3:66394396-66394418 GAAAAAATGCAGTTGCTGATTGG + Intronic
956605763 3:71071513-71071535 TGAAATGTGCAGGCGCAGAGAGG - Intronic
956870121 3:73408539-73408561 GAAAATATCCATGTGCATATTGG - Intronic
960791977 3:121442651-121442673 GAAAATGTACAGGTACACAATGG - Intronic
961865685 3:129952069-129952091 GAAAATGTGTAGGTAGAAATGGG - Intergenic
962378227 3:134876259-134876281 GGAGATGTGCAGGTAAAGATGGG - Intronic
964187764 3:153967114-153967136 GAACATGTGAAGCTGAAGATTGG + Intergenic
964424191 3:156534380-156534402 GAACCTGTGCAGGTGAAGGTGGG - Intronic
964834083 3:160918021-160918043 GCAAGTGTGCATGTGCAGCTGGG - Intronic
967804517 3:193703536-193703558 GAAAAAGAGCAGGTACAGAATGG + Intergenic
968552034 4:1228747-1228769 GACACTGAGCAGGTGCAGCTGGG + Intronic
969317534 4:6391052-6391074 GAAAATGTGAAGGGGCTGGTGGG + Intronic
969545507 4:7824067-7824089 TAAACTCTGCAGGTGCAGCTTGG - Intronic
971579670 4:28319397-28319419 GAAAAGGTGCAGGACCACATGGG + Intergenic
971734516 4:30429133-30429155 GTAAATGTGCAAGAGCACATGGG + Intergenic
973023522 4:45235566-45235588 GAAATTGTGAAGGAACAGATGGG - Intergenic
974964006 4:68737423-68737445 TAAAATGTCCAGGTACAGAAAGG - Intergenic
974995751 4:69156986-69157008 GAAAAGGTGCAGCTGCAGGATGG - Intronic
976003807 4:80403055-80403077 GAAAAGGTGCAGGTGTATTTGGG + Intronic
978555837 4:109979461-109979483 GCAAATGTGTTGGTGGAGATGGG + Intronic
981746035 4:148053242-148053264 GAAATTGTGCAGTTGCATATGGG + Intronic
981835832 4:149052272-149052294 GAAAATCTGCAGGAGAGGATAGG - Intergenic
982176806 4:152713341-152713363 TAAAATAAGCAGGTGCAGAAGGG + Intronic
982959279 4:161816224-161816246 GTTAATGTGCAGGTGAAGATGGG + Intronic
984083558 4:175280469-175280491 AAAAATGTGCAGATGCAGACTGG - Intergenic
988937876 5:36107232-36107254 GACAATGTGCATGAACAGATAGG - Intronic
989833062 5:45945422-45945444 CAAAATGTCCATGTGCAGAATGG - Intergenic
989844190 5:46119328-46119350 CAAAATGTCCATTTGCAGATTGG + Intergenic
990013439 5:51027765-51027787 GAAAATGTTCAGGTGATGATAGG + Intergenic
990859458 5:60310650-60310672 GAGCATGTGCAGATGCACATGGG - Intronic
991441484 5:66654529-66654551 GGAAATGTTCAGGTGCACAGAGG + Intronic
991597156 5:68317309-68317331 AAAAATGTGCAGATGCATCTTGG - Intergenic
992883468 5:81133455-81133477 GGGAATCTGCAGGTGCAGTTTGG + Intronic
992883749 5:81136993-81137015 GACAATATGCAAGTTCAGATGGG - Intronic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
994859831 5:105176329-105176351 AAAAATGTGCAGGTGTGGAGTGG - Intergenic
994917212 5:105995495-105995517 GAACATGACCAGTTGCAGATAGG + Intergenic
995819684 5:116215882-116215904 GAAAATTTGCAGATGAATATTGG + Intronic
996085502 5:119300899-119300921 GAAGAATTGCAGGTGCAGATGGG + Intronic
996507283 5:124282124-124282146 GGAGACGTGCAGGTGCAGCTGGG - Intergenic
996935699 5:128945703-128945725 AAAAAAGTGCAGGACCAGATGGG - Intronic
997229392 5:132231669-132231691 GGAGAAGTGCAGGTGAAGATGGG - Intronic
998600193 5:143577500-143577522 ACAAATGTGAAGTTGCAGATAGG + Intergenic
999190320 5:149742292-149742314 TGCAGTGTGCAGGTGCAGATGGG - Intronic
1000318847 5:160118557-160118579 GGGAGGGTGCAGGTGCAGATGGG - Intronic
1001133285 5:169081479-169081501 CCAAATGTGCAGGTGCTAATGGG + Intronic
1001908551 5:175494450-175494472 GAAAATATGCAAGTGCAGCCGGG + Intronic
1003142424 6:3482567-3482589 GAAAAGGTGCAGGTGGAGAAGGG - Intergenic
1003245986 6:4382645-4382667 GAAAATCTGCAGAAGCAGATTGG + Intergenic
1003264304 6:4552013-4552035 GAAACTGTGCAGGTGGTGGTGGG + Intergenic
1006461000 6:34158036-34158058 GAGAATGTGCAGGGCCAGAGTGG + Intergenic
1007867228 6:44985559-44985581 GAGTATGTCCAGGTGCATATGGG - Intronic
1008000356 6:46353396-46353418 GAGACAGTGCAGGTGCAGGTGGG + Intronic
1008793801 6:55274951-55274973 GAAAATCTCCAGGCCCAGATAGG - Intronic
1009031403 6:58063103-58063125 GAAAAAGTGCATGTTCAGAGAGG - Intergenic
1009262881 6:61517808-61517830 CAAAATGTGCATTTGCAGAATGG - Intergenic
1009424418 6:63498533-63498555 GACATTGTGTAGGTGAAGATCGG - Intergenic
1010288817 6:74111825-74111847 CAAAATGTGCATGTGCTGTTGGG - Intergenic
1012479698 6:99652844-99652866 CAAAATGTGCAAATGCAGAGAGG - Intergenic
1013138711 6:107309219-107309241 GAAAATGTGCAGGTGAAATTAGG - Intronic
1013272201 6:108555782-108555804 GAAAATGTGCACTTGCTGAAGGG + Intergenic
1019023760 6:168941214-168941236 GGAATTGTGCCAGTGCAGATAGG - Intergenic
1020107866 7:5430502-5430524 GAAAAAGTTGAGGTGCAGAAAGG + Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1022959130 7:35409524-35409546 GAAACTGGGGAGGGGCAGATGGG - Intergenic
1023068390 7:36402577-36402599 GAAAAAGAGCAGGTCCAGATTGG - Intronic
1023707965 7:42961999-42962021 GAAAATTTGCAGGTTTTGATAGG - Intergenic
1024429739 7:49273302-49273324 AAGAGTGTGCAGGTGGAGATCGG - Intergenic
1024901826 7:54327080-54327102 GATATAGTGCAAGTGCAGATGGG - Intergenic
1025500440 7:61285525-61285547 GAGAATGTGCATGTGGATATTGG + Intergenic
1025515297 7:61631749-61631771 GAGAATGTGCATGTGGATATTGG + Intergenic
1025527480 7:61834066-61834088 GAAAATGTCCATTTGCAGAATGG + Intergenic
1025539638 7:62060575-62060597 GAGAATGTGCATGTGGATATTGG + Intergenic
1026095572 7:67343760-67343782 GAGCAGGTGCAGATGCAGATCGG - Intergenic
1028090355 7:86693015-86693037 TAATATGAGCAGGTCCAGATAGG + Intronic
1031128494 7:117803492-117803514 GAACATGTGCAGGTTCACATTGG - Intronic
1031928892 7:127664453-127664475 GAAAATGGGGAGGTGCTGAGAGG + Intronic
1032750322 7:134833345-134833367 GATAACGTGCAGATACAGATGGG - Intronic
1035322256 7:158039868-158039890 GACAATGTGTAGGAACAGATGGG + Intronic
1037247734 8:16855845-16855867 TAAAATGGGCAGGGGCAGAAAGG - Intergenic
1038235467 8:25748838-25748860 GAAAATGGGCATGTGCAACTTGG - Intergenic
1041404441 8:57482708-57482730 GAAAATGTGCATGTGTATGTGGG - Intergenic
1041592929 8:59610896-59610918 GATAAAGTGCAGGTGAAGATGGG - Intergenic
1041836162 8:62218476-62218498 GATAATGTGCAGTAACAGATAGG - Intergenic
1042047524 8:64670618-64670640 GAGAATGTGCTGCTGCAGTTTGG - Intronic
1043183428 8:77114157-77114179 GCACATGTGAAGGTGGAGATGGG - Intergenic
1045215838 8:100147431-100147453 CAAAATGTGCAAGAGCAGTTGGG + Intergenic
1046680404 8:117163446-117163468 GAAAAGATGAATGTGCAGATTGG - Exonic
1047023042 8:120796680-120796702 GAAAATAGGCAGGGGCAGACAGG + Intronic
1048455753 8:134576884-134576906 TAAAATGTACAGGGGCAGTTTGG + Intronic
1048580776 8:135728513-135728535 GTGGATGTGCAGGTGGAGATGGG - Intergenic
1049758807 8:144322635-144322657 GGAACTGTGTAGGTGTAGATGGG - Intronic
1049970587 9:818554-818576 GAAAAGGTAGAGGTGAAGATCGG + Intergenic
1050512827 9:6413061-6413083 GAAAATGGGCAGGCGCGGAGAGG - Intergenic
1051107846 9:13601009-13601031 GAGAATGTGCAAGTGCAAAATGG - Intergenic
1051261192 9:15266651-15266673 GAACATGTGCATGTACAGGTGGG - Intronic
1052043698 9:23770246-23770268 GAAAATGTGGAGATGAAGACGGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053838574 9:42167627-42167649 GAAAATGTTCAGGCACAGAATGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057820471 9:98326447-98326469 GAGAATATGCATGAGCAGATGGG - Intronic
1061935304 9:133854220-133854242 GTATGTGTGCAGGTGCACATGGG - Intronic
1062303244 9:135887658-135887680 GACAAACTGCAGGTGCTGATGGG - Intronic
1062470840 9:136703515-136703537 GGAAAGGTGCAGGAGCAGCTGGG - Intergenic
1062715698 9:138009036-138009058 GAAACTGTGCAGGGGCAGGGAGG + Intronic
1185700992 X:2229939-2229961 GAATATGTGCATGTGTCGATAGG + Intronic
1186779868 X:12901760-12901782 AAAAAGGTGCAGGTGCAGGAAGG + Intergenic
1189110873 X:38287146-38287168 GAAAATGTGAAGGTGCATGGAGG - Exonic
1189249237 X:39587266-39587288 GAAAAGATGAAGGTGGAGATGGG - Intergenic
1189302695 X:39963924-39963946 TTAAATGTGCTGGTGCAGCTGGG + Intergenic
1189364554 X:40378347-40378369 GAAAAAGTGGAGGTGCTGGTAGG - Intergenic
1189388729 X:40558194-40558216 GAGAAGGTGCAGGTAGAGATGGG - Intergenic
1189886930 X:45556544-45556566 GGAAATTTGAAGTTGCAGATAGG + Intergenic
1191269223 X:58441277-58441299 CAAAATGTACAGTTGCAGAATGG + Intergenic
1191274491 X:58524810-58524832 CCAAATGTCCAGTTGCAGATTGG - Intergenic
1192189920 X:68984564-68984586 TATACTGTGCAGGTGCAGAGGGG - Intergenic
1194071731 X:89332487-89332509 AAAAATATGGAGGTGCAGACAGG - Intergenic
1194321303 X:92448989-92449011 TTAAATGTGCAGTAGCAGATAGG + Intronic
1196856868 X:119992382-119992404 AAAAATGTGCAGGAGCAGTTGGG + Intergenic
1198072698 X:133165094-133165116 GAGAATGTGCACCTGCAGGTAGG - Intergenic
1198209394 X:134502638-134502660 GAAGAAGTGCAGGTCCAGAGAGG + Intronic
1199428343 X:147729877-147729899 GGAAATGAGCAGGTGTATATGGG - Intergenic
1199608504 X:149594854-149594876 CAGAATGTGCACATGCAGATGGG - Intergenic
1199630618 X:149774506-149774528 CAGAATGTGCACATGCAGATGGG + Exonic
1200725979 Y:6668215-6668237 AAAAATATGGAGGTGCAGACAGG - Intergenic