ID: 1152684964

View in Genome Browser
Species Human (GRCh38)
Location 17:81689419-81689441
Sequence CTAGTTCTCCACGGCCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152684964_1152684969 -4 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684969 17:81689438-81689460 CTAGGGGATTGTGTAGAGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 134
1152684964_1152684971 0 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684971 17:81689442-81689464 GGGATTGTGTAGAGAGAGGTGGG 0: 1
1: 0
2: 2
3: 20
4: 283
1152684964_1152684973 2 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684973 17:81689444-81689466 GATTGTGTAGAGAGAGGTGGGGG 0: 1
1: 1
2: 0
3: 19
4: 341
1152684964_1152684976 20 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684976 17:81689462-81689484 GGGGGCTTCAGGATGCATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 198
1152684964_1152684974 9 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684974 17:81689451-81689473 TAGAGAGAGGTGGGGGCTTCAGG 0: 1
1: 0
2: 4
3: 32
4: 409
1152684964_1152684972 1 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684972 17:81689443-81689465 GGATTGTGTAGAGAGAGGTGGGG 0: 1
1: 0
2: 2
3: 28
4: 288
1152684964_1152684975 19 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684975 17:81689461-81689483 TGGGGGCTTCAGGATGCATTTGG 0: 1
1: 0
2: 0
3: 13
4: 194
1152684964_1152684970 -1 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684970 17:81689441-81689463 GGGGATTGTGTAGAGAGAGGTGG 0: 1
1: 0
2: 4
3: 34
4: 379
1152684964_1152684977 28 Left 1152684964 17:81689419-81689441 CCATTGTGGCCGTGGAGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1152684977 17:81689470-81689492 CAGGATGCATTTGGGAGTCTTGG 0: 1
1: 0
2: 1
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152684964 Original CRISPR CTAGTTCTCCACGGCCACAA TGG (reversed) Intronic
900347524 1:2216734-2216756 CTGGTTCCCAATGGCCACAATGG + Intergenic
903503909 1:23819278-23819300 CAAGTTCTCAAGGGCCACATGGG + Intronic
909245972 1:73284923-73284945 CTAATTCTCCACAGCCTCACCGG - Intergenic
913670537 1:121094091-121094113 CTAGTTGACCACTGCCAAAAGGG + Intronic
914022303 1:143881530-143881552 CTAGTTGACCACTGCCAAAAGGG + Intergenic
914660788 1:149789471-149789493 CTAGTTGACCACTGCCAAAAGGG + Intronic
915278619 1:154807274-154807296 CGAGTTGTCCACAGCCACCAGGG - Intronic
922236214 1:223724468-223724490 CAAGTGCTCCACAGCCACACAGG - Intronic
1062907602 10:1189356-1189378 CCACTTCTCCACGGCCAGGAAGG - Intronic
1063382158 10:5592227-5592249 CAACTTCTCCACGGCCACCCAGG + Intergenic
1065168411 10:23004701-23004723 CTAGTTCTCCACTACCACGATGG - Intronic
1065508163 10:26450620-26450642 CTAGTTTTCCACAGCCATAGTGG - Intronic
1066494617 10:35930489-35930511 CTATTTCTCCACAGCCTCATCGG + Intergenic
1067575974 10:47408947-47408969 TTGGTTCTCCTCGGCCCCAAAGG + Intergenic
1075311007 10:121413328-121413350 CCAGTTCTCCACGTACACGATGG + Intergenic
1076013318 10:127007496-127007518 CTACTGCTCCACCGCCACACTGG - Intronic
1076761519 10:132608271-132608293 CCAGCTCTCCACGGCCCCACTGG - Intronic
1090140591 11:124255802-124255824 CCACTGCTCCCCGGCCACAATGG + Intergenic
1092306407 12:7305571-7305593 CTACTTATCCAAGGCCACACAGG + Intronic
1096486402 12:51984720-51984742 CTGGTTGACCAGGGCCACAATGG + Intronic
1096744012 12:53713811-53713833 CTGGGTCTCCACGCTCACAAAGG + Exonic
1096815876 12:54201494-54201516 CTGCCTCTGCACGGCCACAAGGG - Intergenic
1104978178 12:132561353-132561375 CAAGCTCCCCAGGGCCACAAGGG - Intronic
1110525820 13:76535657-76535679 CTATTTCTCCACAGCCTCACTGG - Intergenic
1113163307 13:107408571-107408593 CTAGTTCTGTATGGACACAATGG + Intronic
1114348429 14:21822953-21822975 CTATTTCTCCACATCCTCAATGG - Intergenic
1117331796 14:54719713-54719735 CTATTTCTCCAAGGTCACACAGG - Intronic
1128370594 15:67036342-67036364 CTACTTGTCCAAGGCCACACAGG + Intergenic
1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG + Exonic
1152684964 17:81689419-81689441 CTAGTTCTCCACGGCCACAATGG - Intronic
1155848260 18:30736441-30736463 CTATTTCTCCACAGCCTCACCGG - Intergenic
1160508851 18:79442172-79442194 CCAGTTCTCCACGGCAAGCACGG + Intronic
1164069663 19:21755440-21755462 CTATTTCTCCACAGCCTCACCGG - Intronic
1165021558 19:32928553-32928575 CGAGTTCTGCCCAGCCACAATGG - Intronic
1168638197 19:58012672-58012694 AAAGATCTCCACGGCCACAGTGG + Intergenic
926714567 2:15914020-15914042 TCAGTGCTCCACTGCCACAAGGG + Intergenic
927432943 2:23042181-23042203 CTCTTTTCCCACGGCCACAAAGG + Intergenic
927516016 2:23672091-23672113 CAAGTTCATCACGGCCACCATGG + Intronic
929964403 2:46522875-46522897 CTATTTCTCTACGGCCTCACTGG + Intronic
934656456 2:96118919-96118941 CCAGCTCTCCACGGCCACGCAGG + Intergenic
946147832 2:217744215-217744237 CCAGGTCTCCAGGGCCCCAAGGG + Intronic
948862715 2:240760712-240760734 CTGGACCTCCACGGCCACAATGG + Exonic
948953567 2:241271077-241271099 CTTGTTCTCCATGGCCAGAAAGG - Intronic
1169209743 20:3759374-3759396 CGGGTTCTCCAAGGCCAGAAAGG + Intronic
1172707903 20:36896318-36896340 CTAGTTCCCCACAGACACCAAGG + Intronic
1177388619 21:20438706-20438728 CTATTTCTCCACAGCCTCACCGG - Intergenic
1179006988 21:37523821-37523843 CAAGTTGTCCACGGCCACTTTGG + Intergenic
1181521907 22:23453009-23453031 CTAGAACGCCACGGCCACAGAGG - Intergenic
1183828636 22:40406562-40406584 CTGAGTCTCCACGGCCACATCGG - Exonic
1184348874 22:43930203-43930225 CAAGTTCCCCACAGCCACACAGG - Intronic
956813030 3:72883211-72883233 CAAGTGCTCCACAGCCACATGGG + Intergenic
959425782 3:106186129-106186151 CAATTTTTCCACGGCCACATAGG + Intergenic
964769127 3:160205885-160205907 CTAGTTCCCCAGGACCAGAATGG - Intergenic
965549124 3:169946492-169946514 CTTGTTGTCCTTGGCCACAAAGG + Intergenic
970860960 4:20701709-20701731 CCAATTCTCCACGGACACCAAGG - Intronic
973748418 4:53987225-53987247 CTATTTCTTCACGGGTACAAGGG - Intronic
974874468 4:67686208-67686230 CAAGTTCTCTATGGCCCCAAGGG - Intronic
980837621 4:138216441-138216463 TGAGTTCCCCAGGGCCACAAGGG + Intronic
993411029 5:87573315-87573337 ATTGTTTTCCACGGCCATAATGG + Intergenic
998514016 5:142736628-142736650 CTAGATCTCCAGGTCCACACAGG - Intergenic
1000407708 5:160906370-160906392 CAAGTTCTCCTGGGCCAAAAAGG + Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1018513237 6:164549570-164549592 CTATTTCTCCACGGCCTCATTGG + Intergenic
1019589440 7:1823501-1823523 CTAGAACGCCACGGCCACAGGGG + Intronic
1021342558 7:19482374-19482396 CTAGTGCTCCACCTCCTCAATGG + Intergenic
1022873340 7:34502554-34502576 ATAATTCCCCATGGCCACAATGG - Intergenic
1023845388 7:44117329-44117351 CCAGTTCTCCACAACCACATTGG + Intronic
1025073981 7:55926570-55926592 CTAATTCTGCACGCCCACTAGGG + Intronic
1029215619 7:98947148-98947170 GGAATTCTCCATGGCCACAAGGG - Intronic
1032362219 7:131266573-131266595 ATAGTTCTACATGGCCACACAGG + Intronic
1035530688 8:348561-348583 CCAGGTGTCCCCGGCCACAAGGG + Intergenic
1038610959 8:29059897-29059919 CAAGTTCCCCTCGGCCACACAGG - Intronic
1047310049 8:123684372-123684394 CTAGCTCTCCAGAGCCACAGAGG + Intronic
1049818733 8:144621311-144621333 CAAGTTTTCCACGGCCCCCAGGG + Intergenic
1050025612 9:1331704-1331726 CTTGTTCTCAAAGGCCACCAAGG - Intergenic
1057878706 9:98777084-98777106 CTGGTTCTCCACAGCCCAAATGG + Intronic
1060185962 9:121564453-121564475 CTAGTCCTCCAAGGCCCCAGGGG - Intergenic
1186383431 X:9085265-9085287 CCAATTCTCCACGGACACCAAGG + Intronic
1188923711 X:36012173-36012195 CTATTTCTCCACAGCCTCACCGG - Intergenic
1190062521 X:47220239-47220261 CTGGTCCTCCGCGGACACAAGGG - Intronic
1194133413 X:90109870-90109892 CTATTTCTCCACGGCATCACTGG - Intergenic
1195244442 X:102982900-102982922 CTACTTGCCCAAGGCCACAAAGG - Intergenic
1196531406 X:116791188-116791210 CTAGTTCTCCACCCCCAGACAGG - Intergenic
1198394310 X:136207095-136207117 CTTGTTGTCCTTGGCCACAAAGG - Exonic
1200479194 Y:3679973-3679995 CTATTTCTCCACGGCATCACTGG - Intergenic