ID: 1152685129

View in Genome Browser
Species Human (GRCh38)
Location 17:81690161-81690183
Sequence ACTATGGCTTCATCTCTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152685126_1152685129 -3 Left 1152685126 17:81690141-81690163 CCAGGTGGGAGCAGGCAGTGACT 0: 1
1: 0
2: 1
3: 33
4: 232
Right 1152685129 17:81690161-81690183 ACTATGGCTTCATCTCTCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 162
1152685121_1152685129 14 Left 1152685121 17:81690124-81690146 CCCGGAAGTCTTGCAGGCCAGGT 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1152685129 17:81690161-81690183 ACTATGGCTTCATCTCTCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 162
1152685122_1152685129 13 Left 1152685122 17:81690125-81690147 CCGGAAGTCTTGCAGGCCAGGTG 0: 1
1: 0
2: 2
3: 13
4: 185
Right 1152685129 17:81690161-81690183 ACTATGGCTTCATCTCTCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152685129 Original CRISPR ACTATGGCTTCATCTCTCCA GGG Exonic
902291034 1:15434930-15434952 ACTATTGCTTCATAGCTCTATGG - Intergenic
902488025 1:16760872-16760894 CCTGTGCCTTCTTCTCTCCAGGG - Intronic
903408172 1:23116467-23116489 ACTATGGTTTCATCACTGCTGGG + Intronic
903891847 1:26574977-26574999 ACTCAGGGTTCATCTGTCCATGG + Intronic
905233833 1:36531814-36531836 ACTATACCATCATCTCTCCTGGG - Intergenic
906287890 1:44599692-44599714 ACCATGCCATCATCTCCCCATGG - Intronic
907819564 1:57953845-57953867 CCTATGGCTACATGTCTCAATGG + Intronic
912470491 1:109903389-109903411 ACTATGGGTTCATGTCTTCTTGG - Intergenic
913657942 1:120979330-120979352 AATTTGCCTTCCTCTCTCCATGG + Intergenic
914647921 1:149671054-149671076 AATTTGCCTTCCTCTCTCCATGG + Intergenic
919842492 1:201619409-201619431 ACTCTACCTTCATCTCTCCTGGG - Intergenic
922553124 1:226511908-226511930 ACTATAGCACCATCTCTCCTTGG - Intergenic
923453408 1:234141285-234141307 AGTATGGCTCCAGCTCTACATGG + Intronic
1065155372 10:22864450-22864472 ACTATGCCATCAGCTCTCCCTGG - Intergenic
1066521023 10:36219265-36219287 ACTTTGGCACCATCTCTCAATGG + Intergenic
1068007271 10:51406404-51406426 ACTCTGGCTTCATCTCGCCTGGG - Intronic
1069304104 10:66947054-66947076 ACTTTTACTTAATCTCTCCAGGG + Intronic
1070107364 10:73447274-73447296 ACTACTGCTTCATCTCTAAAGGG + Intronic
1076105438 10:127818955-127818977 AAAATAGCTTCATCTCTTCATGG + Intergenic
1077292001 11:1801436-1801458 ACTCTGGCTTCATTTATTCAAGG + Intergenic
1077949759 11:6943649-6943671 ACTATGGCCTCATATCTACCTGG - Intronic
1078032134 11:7763702-7763724 ACTTTGGCTTCATGTCTCAAAGG - Intergenic
1079359095 11:19755653-19755675 TCTTTGGCTTCATCTTTACATGG + Intronic
1081003747 11:37707399-37707421 ACTAAAGCTTCATCTCACCTTGG + Intergenic
1081584401 11:44374495-44374517 CATATGACCTCATCTCTCCAAGG - Intergenic
1087912044 11:103765186-103765208 AATATGGCTTCACCTCTCTCTGG + Intergenic
1088561654 11:111121671-111121693 TCTATGGCTCCAGCTCTCCCTGG - Intergenic
1090172035 11:124613610-124613632 AATCTGGTTTAATCTCTCCAGGG + Intronic
1090618465 11:128539632-128539654 AATATGTTTTCATTTCTCCAGGG - Intronic
1090747650 11:129720210-129720232 ACTAAGGCTTCCTCTCTGCCAGG - Intergenic
1092696544 12:11177862-11177884 CATATGGCTTCATCTCTGCAAGG + Intergenic
1093236218 12:16610860-16610882 AGTTTGGCTTCATCTGTCCCAGG - Intergenic
1093433903 12:19113636-19113658 ACTATGGCCTCAAATCTCCTGGG - Intergenic
1095044160 12:37481361-37481383 GCTATGGCCTCAGCTCTCAAGGG + Intergenic
1095049543 12:37543932-37543954 ACTCTGGCCTGACCTCTCCACGG + Intergenic
1095241036 12:39859121-39859143 ACTGTGGCTTCATCTGTAGATGG - Intronic
1095443581 12:42261900-42261922 ACTAAGATTTCATCTCTCCTAGG - Intronic
1101204886 12:102476686-102476708 ATTATGGCTTCATCTCTTGGAGG + Intronic
1103961918 12:124614248-124614270 ACCCTGGCTTCATCCCTCCTGGG - Intergenic
1104276509 12:127333521-127333543 GCCATTTCTTCATCTCTCCATGG + Intergenic
1105819897 13:24070889-24070911 ACTATGTCCTCAGCTCTCCCAGG + Intronic
1107727564 13:43314889-43314911 ATTTTAGCTTCATCTCTCAAAGG + Intronic
1112180391 13:97073199-97073221 ACTATTGCTTGCTCTGTCCATGG - Intergenic
1113328860 13:109310057-109310079 ACAATGACGTCATCTCACCAAGG - Intergenic
1113535403 13:111062388-111062410 ATCATGGCTTCATCTCTCTCTGG + Intergenic
1113615666 13:111678756-111678778 ACTTTCGCTTCTTATCTCCATGG - Intergenic
1113621134 13:111763658-111763680 ACTTTCGCTTCTTATCTCCATGG - Intergenic
1113975727 13:114225863-114225885 ACTTTGGCTTCACCACTGCAGGG - Intergenic
1114916860 14:27279207-27279229 AAGATGTCTTCTTCTCTCCAAGG - Intergenic
1116130287 14:40847672-40847694 ACTGGGGCTGCATCTGTCCAGGG + Intergenic
1117623127 14:57608401-57608423 TCTCTGGCTTCATCTTTACATGG - Intronic
1120195201 14:81474429-81474451 AGTGTGGCTTCATTTGTCCATGG - Exonic
1129474537 15:75775970-75775992 TCTTTGGGCTCATCTCTCCAAGG + Intergenic
1130125927 15:81094206-81094228 ACTGGGGCTTCATCTCTCTGGGG - Intronic
1131547730 15:93329896-93329918 ACTCTGCCTTCATCTTTCTATGG + Intergenic
1132974787 16:2705856-2705878 ACTTTGGCTGCAGGTCTCCAGGG + Intronic
1133202447 16:4212547-4212569 ACTGGGGATTCACCTCTCCAGGG - Intronic
1133888774 16:9858015-9858037 ATTAGGGCAGCATCTCTCCAAGG - Intronic
1134900118 16:17930342-17930364 AACATGTCTTCATCTCTCCCAGG - Intergenic
1136098373 16:27974982-27975004 TCTATGGCTTCACCTCTTCCAGG - Intronic
1138085929 16:54133928-54133950 ACTATGGCTTCATTCCTACTTGG - Intergenic
1138224913 16:55284844-55284866 AACATGGCTTCATCACCCCACGG - Intergenic
1138968545 16:62116271-62116293 AGTATGGCTTTTTCTCTTCAGGG + Intergenic
1139255632 16:65539420-65539442 AATATGATTGCATCTCTCCAGGG + Intergenic
1139782945 16:69366805-69366827 ACTTGGGATTCTTCTCTCCAGGG + Exonic
1140265996 16:73421740-73421762 ACCCTAGTTTCATCTCTCCAGGG + Intergenic
1150936975 17:69647211-69647233 AATATGGCTGCTTTTCTCCATGG + Intergenic
1152685129 17:81690161-81690183 ACTATGGCTTCATCTCTCCAGGG + Exonic
1153408679 18:4769375-4769397 ACTGAGGCATCTTCTCTCCAAGG - Intergenic
1153559517 18:6357983-6358005 GCTTTGTCTTCATCTGTCCAAGG - Intronic
1153953454 18:10076314-10076336 ACTATGGCCTCCTGTCCCCATGG + Intergenic
1156012654 18:32512528-32512550 ACCATGCCTTCATCTCACCTAGG - Intergenic
1158533402 18:58283950-58283972 TCTCTGCCTTCATCTTTCCATGG - Intronic
1160125967 18:76172051-76172073 TCAATGGCTTCTTCTCCCCAGGG + Intergenic
1164864435 19:31592215-31592237 AGGATGGCTTCATCACACCATGG - Intergenic
1165184758 19:34008173-34008195 AGTATGGTTTCATTGCTCCAGGG - Intergenic
1165683353 19:37796511-37796533 GCTCTGGCTTGACCTCTCCAGGG - Intronic
1202703174 1_KI270713v1_random:3368-3390 CCTGTGCCTTCTTCTCTCCAGGG + Intergenic
925029613 2:639407-639429 ACAATGGCTGCATCTGTCCTGGG + Intergenic
925318197 2:2940756-2940778 ACTGCGGATTGATCTCTCCATGG + Intergenic
926591431 2:14744199-14744221 ACTATGCCTACATCTCTCCTTGG + Intergenic
927102441 2:19798591-19798613 ACTAAGGCTTCCACTCTTCAGGG + Intergenic
927249719 2:20986731-20986753 AGCATGGCTTAACCTCTCCAAGG - Intergenic
930518877 2:52438038-52438060 ACTATTGATCCATCTATCCATGG - Intergenic
932410074 2:71542012-71542034 ACTCTGCCTTCAGCTGTCCATGG - Intronic
933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG + Intergenic
936091812 2:109506463-109506485 AGTGTGGCTCCCTCTCTCCAGGG - Intergenic
937652216 2:124333190-124333212 ACTATAGCTTCAACTTCCCAAGG - Intronic
939772827 2:146344395-146344417 ACTATGGCAACATCTGTCTAAGG - Intergenic
942519763 2:176791119-176791141 ATCATGGCTTCAACTCTCCATGG + Intergenic
945009924 2:205449990-205450012 ACTATAGATTTATCTTTCCAGGG + Intronic
946115729 2:217460451-217460473 ACTATGGTTTCAGATCTCCTAGG + Intronic
946892544 2:224293151-224293173 ACTGTGACTTCATCTGTCCTTGG + Intergenic
947074122 2:226323235-226323257 ACAATGGCTGCATATCTCAAAGG + Intergenic
947682111 2:232044322-232044344 ACTGTGACTTCATCTCTCACTGG - Intronic
948494928 2:238341826-238341848 ACTGGCGCTTCCTCTCTCCATGG - Intronic
948532731 2:238622120-238622142 GCTATGGCTCCATCTGTCCTGGG - Intergenic
949042562 2:241856050-241856072 GCTCTGCCTTCATCTCTGCACGG - Intronic
1168953963 20:1821273-1821295 ACTGTAGCTTCATCTCTCACCGG + Intergenic
1172127210 20:32631862-32631884 ACTGTGGCTCCCTCTCCCCAAGG + Intergenic
1172467895 20:35170397-35170419 ACTATGACGTCAGCTCTCCGGGG + Intergenic
1175134755 20:56814850-56814872 ACTTTAGCTTCATGTCTTCAAGG + Intergenic
1175384240 20:58584029-58584051 ACTCTGGCATCATTTCTGCAGGG - Intergenic
1176679648 21:9812555-9812577 ACTCCGGCCTCACCTCTCCACGG - Intergenic
1176681354 21:9821014-9821036 ACTCCGGCCTCACCTCTCCACGG - Intergenic
1180613915 22:17115219-17115241 ACCATGTCTTCATTTCTCCCTGG - Exonic
1180748118 22:18105925-18105947 ACTATGTCTTCAGCTCTCCTGGG - Intronic
1180748224 22:18106831-18106853 ACTACGTCTTCAGCTCTCCCGGG - Intronic
1180769673 22:18372205-18372227 GTTATGGGTTCATCTCCCCACGG - Intergenic
1181700799 22:24620307-24620329 ACTATGGCTCTCTCTCCCCAGGG + Exonic
1181771801 22:25131213-25131235 AGCATGGCCTCAGCTCTCCAGGG - Intronic
1182444560 22:30382559-30382581 ATTATGGCATAAGCTCTCCAGGG + Intronic
1182521386 22:30886475-30886497 ACTCTTACTTCATCTCTTCAGGG + Intronic
951268892 3:20602003-20602025 AGTCTGGCTTCCTCTCTCGAGGG + Intergenic
953545058 3:43858218-43858240 ACTAAGCCTTCATCTCTACAGGG + Intergenic
953631500 3:44621845-44621867 ACTATACCTTCAGCTCTCCTGGG + Intronic
954134627 3:48576295-48576317 AGTTTGTCTTCATCTCTCCAGGG - Exonic
954298656 3:49687667-49687689 CCTGTGCCTTCTTCTCTCCAGGG - Exonic
960847917 3:122021964-122021986 ACAATGGCTTCCTGTCTCCTTGG + Intronic
962350535 3:134652534-134652556 TCTATGGCCTCAGCTCTCTAGGG - Intronic
963420145 3:145051756-145051778 ACCATGTCATCAGCTCTCCAGGG + Intergenic
963749707 3:149163858-149163880 ATTATGGCTTAATTTATCCATGG + Exonic
963785707 3:149532369-149532391 ACTTTGGTTTAATCCCTCCAAGG - Intronic
969701270 4:8769120-8769142 ACTGTGGCTTCCTCGTTCCAGGG - Intergenic
975396066 4:73874670-73874692 ACCAGGGCTTCATCTTGCCATGG - Intergenic
976703948 4:88002349-88002371 ACTCAGACTTCATCTCTCCCTGG - Intergenic
978037487 4:104013722-104013744 ACTAGGGCTTCATCTCAAGATGG - Intergenic
979169759 4:117585800-117585822 ACTGTGTGTTCTTCTCTCCAAGG + Intergenic
979249125 4:118545570-118545592 ACTCTGGGTTCATTTCTCAAAGG + Intergenic
981264058 4:142759921-142759943 ATTATTGATTCAGCTCTCCAAGG + Intronic
985762140 5:1754749-1754771 GCTGTGGACTCATCTCTCCAGGG + Intergenic
986158356 5:5199436-5199458 ACTATGGCTTCATGTATTTATGG - Intronic
991620777 5:68543584-68543606 CCTATGGCTGCTTCTGTCCAGGG + Intergenic
992388014 5:76304438-76304460 TCTATAGCTTCATCTCCCCATGG + Intronic
993104844 5:83588519-83588541 ACCATGGCTTCATCTGTGTAGGG + Intergenic
997789529 5:136744745-136744767 ACTATGGCTAAATCTGTCCAAGG + Intergenic
1003598672 6:7498185-7498207 GCTATGCCCTCATCTATCCAAGG + Intergenic
1005810359 6:29510699-29510721 ACCATGGGTTCATCTCTCCCAGG - Intergenic
1009287238 6:61835159-61835181 ATTTTGGCTGCATCTCTCCAAGG - Intronic
1009786367 6:68345099-68345121 ACCTTGGCTTCATGTCTTCAAGG - Intergenic
1012528897 6:100210800-100210822 ACTGAGGCTTCATGTTTCCATGG - Intergenic
1013181676 6:107721671-107721693 ACTCTTGCTTGATCTCTCCCAGG - Intronic
1013536160 6:111065265-111065287 ACTCTGGCTCCATCTTTACATGG + Intergenic
1018291244 6:162294028-162294050 ACTTTGGCTTCTTGTTTCCAGGG - Intronic
1019801487 7:3091434-3091456 ACTAGGCCTTCATTTCTGCAGGG - Intergenic
1020504279 7:8963917-8963939 ACTATTGCATCATCTATCCCTGG + Intergenic
1022581231 7:31557021-31557043 TCTATGACTTCATCTCTACATGG + Intronic
1024622558 7:51174785-51174807 ACCATGGCTGAATCTCTCCAAGG + Intronic
1025087095 7:56032246-56032268 TCTATGGCTTCAATTCTGCAAGG + Intronic
1025290086 7:57710908-57710930 GCTATGGCCTCAGCTCTCAAGGG + Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1029108368 7:98196463-98196485 ATTATCGCTGCATTTCTCCATGG + Intronic
1034013897 7:147560852-147560874 TCTATGCCTTCCTCTTTCCAAGG - Intronic
1034596901 7:152205099-152205121 ACTATACCATCATCTCTGCAAGG + Exonic
1037185655 8:16059315-16059337 ACTATGTTTCCAGCTCTCCACGG + Intergenic
1038269415 8:26063059-26063081 ACAGTTGCTTCATCTCTCTAGGG + Intergenic
1041935015 8:63324256-63324278 CCTATGCCTTCATTTCTCCCTGG - Intergenic
1044103444 8:88170933-88170955 ACTAATTCTTCATATCTCCATGG - Intronic
1044368084 8:91374175-91374197 ACTATTGTTTCATTTCTCCTTGG + Intronic
1046217509 8:111168109-111168131 ACCATGGCTGCATATCTCTATGG - Intergenic
1046332456 8:112737343-112737365 ACTAGAGCTTCATCTCTTTAAGG + Intronic
1047053031 8:121134470-121134492 ACAATGTCTCCATCTCTCCTGGG - Intergenic
1047909274 8:129509720-129509742 ACTATAGCTTAATCTTTCCAGGG - Intergenic
1054925968 9:70589036-70589058 ACGAAGGCTGCATCTATCCAAGG + Intronic
1055260037 9:74423563-74423585 ACTAGGGCTTTATCACTCCATGG - Intergenic
1057742674 9:97725957-97725979 ACTTTGGCTTAATCCCACCAGGG + Intergenic
1060507139 9:124206390-124206412 ACTAAGGCTCCATGTCACCAGGG + Intergenic
1061995604 9:134181286-134181308 ACTCTGTCTCCATCTCTCCTTGG - Intergenic
1203664815 Un_KI270754v1:15090-15112 ACTCGGGCCTCACCTCTCCACGG - Intergenic
1203665660 Un_KI270754v1:19316-19338 ACTCCGGCCTCACCTCTCCACGG - Intergenic
1203666810 Un_KI270754v1:24954-24976 ACTCCGGCCTCACCTCTCCACGG - Intergenic
1203667959 Un_KI270754v1:30593-30615 ACTCCGGCCTCACCTCTCCACGG - Intergenic
1185871349 X:3667518-3667540 CCTGTGGCTTCCTCCCTCCAAGG + Intronic
1189032807 X:37467255-37467277 ACAATGGCTTCATCTATCTTTGG - Intronic
1197159805 X:123310356-123310378 ACTTTGGCTTCATTTAACCAGGG - Intronic
1197978338 X:132189245-132189267 ACCATGGCTGCAAGTCTCCAAGG + Intergenic
1199965519 X:152817585-152817607 ACTATGTCATCAGCTCTCCTGGG - Intergenic
1200792752 Y:7314144-7314166 CCTGTGGCTTCCTCCCTCCAAGG - Intergenic
1201303954 Y:12534801-12534823 ACTTTGGCTTCCTCACACCATGG + Intergenic