ID: 1152688767

View in Genome Browser
Species Human (GRCh38)
Location 17:81708002-81708024
Sequence GTCCCAGGATACCCCACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152688767_1152688783 30 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688783 17:81708055-81708077 CATGGGGACCGGGAGTGCCGTGG No data
1152688767_1152688779 13 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688779 17:81708038-81708060 CAGGAGGGGCTTGTGGACATGGG No data
1152688767_1152688778 12 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688778 17:81708037-81708059 GCAGGAGGGGCTTGTGGACATGG No data
1152688767_1152688774 -2 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688774 17:81708023-81708045 ACCTGGGCAAAGCGGCAGGAGGG No data
1152688767_1152688777 6 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688777 17:81708031-81708053 AAAGCGGCAGGAGGGGCTTGTGG No data
1152688767_1152688770 -10 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688770 17:81708015-81708037 ATCCTGGGACCTGGGCAAAGCGG No data
1152688767_1152688780 14 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688780 17:81708039-81708061 AGGAGGGGCTTGTGGACATGGGG No data
1152688767_1152688773 -3 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688773 17:81708022-81708044 GACCTGGGCAAAGCGGCAGGAGG No data
1152688767_1152688776 -1 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688776 17:81708024-81708046 CCTGGGCAAAGCGGCAGGAGGGG No data
1152688767_1152688772 -6 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688772 17:81708019-81708041 TGGGACCTGGGCAAAGCGGCAGG No data
1152688767_1152688782 20 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688782 17:81708045-81708067 GGCTTGTGGACATGGGGACCGGG No data
1152688767_1152688781 19 Left 1152688767 17:81708002-81708024 CCTTAAGTGGGGTATCCTGGGAC No data
Right 1152688781 17:81708044-81708066 GGGCTTGTGGACATGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152688767 Original CRISPR GTCCCAGGATACCCCACTTA AGG (reversed) Intergenic
No off target data available for this crispr