ID: 1152689727

View in Genome Browser
Species Human (GRCh38)
Location 17:81712486-81712508
Sequence CGCCTGCTGCACGCACCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152689713_1152689727 29 Left 1152689713 17:81712434-81712456 CCGAGGCGCGCGTGTCGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1152689727 17:81712486-81712508 CGCCTGCTGCACGCACCCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 136
1152689724_1152689727 -10 Left 1152689724 17:81712473-81712495 CCTCCTGCGGGGCCGCCTGCTGC 0: 1
1: 0
2: 0
3: 35
4: 381
Right 1152689727 17:81712486-81712508 CGCCTGCTGCACGCACCCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152689727 Original CRISPR CGCCTGCTGCACGCACCCGC TGG Exonic
900237496 1:1599789-1599811 TGCGTGCTGCACGCCCCGGCCGG - Exonic
900458264 1:2787681-2787703 CGCCTGCGGCGTGCACCAGCTGG - Exonic
900542941 1:3213058-3213080 CGCCTGCCGCACGCTTCCCCGGG + Intronic
901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG + Exonic
907429804 1:54405565-54405587 CGCCCCCTGCCCGCACCCGGTGG + Intronic
907863778 1:58379041-58379063 CGCATGGTGCGCGCACCCACTGG + Intronic
918378379 1:183931507-183931529 CTCCCGCTGCAGGCACCCCCGGG - Intronic
921456850 1:215381047-215381069 GGCCTGCTGCACCCACTCCCTGG - Intergenic
921879990 1:220245298-220245320 CGCATGGTGCGCGCACCCACTGG - Intronic
1063395660 10:5685024-5685046 CGCCGGCTCCGCGCTCCCGCGGG - Exonic
1064418079 10:15168175-15168197 CGCCTGTTGCCCTCGCCCGCGGG - Intronic
1065159928 10:22909004-22909026 CGCCTGCTGCATGCAGCCTAGGG - Intergenic
1065419044 10:25521226-25521248 CGCACGGTGCACGCACCCACTGG + Intronic
1065483616 10:26216762-26216784 CGCCCGCAGCTCGCACTCGCAGG + Exonic
1068074188 10:52233444-52233466 CGCACGGTGCACGCACCCACTGG - Intronic
1073812221 10:107164206-107164228 CGGTTGCTGCACGCTCCGGCCGG - Exonic
1074903328 10:117838748-117838770 CGCATGGTGCGCGCACCCACTGG + Intergenic
1075275888 10:121091984-121092006 TGCCTGCTGTATGCACCAGCTGG - Intergenic
1077134914 11:993686-993708 AGGCTGCAGCACGCCCCCGCGGG - Intronic
1077436050 11:2539724-2539746 CGCCTGCTGCAGGGGCCCCCAGG + Intronic
1080213156 11:29810442-29810464 CCTCTGCTGCACTCACCTGCTGG + Intergenic
1081083236 11:38768849-38768871 CTCCTGCTGCACACACATGCCGG - Intergenic
1082586411 11:54947108-54947130 CACATGGTGCACGCACCCACTGG - Intergenic
1083970291 11:66070340-66070362 AGCGAGCTGCACGCACGCGCGGG - Intergenic
1084006747 11:66327088-66327110 TGCCTGCTGGACGCAGCCCCTGG - Intergenic
1087615436 11:100481579-100481601 CGCATGGTGCGCGCACCCACTGG + Intergenic
1088204095 11:107372902-107372924 CGCATGGTGCGCGCACCCACTGG - Intronic
1090105650 11:123851732-123851754 CGTCTGCTGCCCCCACCCCCAGG - Intergenic
1090290211 11:125536751-125536773 CGCACGGTGCACGCACCCACTGG - Intergenic
1090939136 11:131372302-131372324 CGTCTGCTGCACCCAACCCCAGG + Intronic
1091715834 12:2775544-2775566 GGCCTGCCGCACCCACCAGCTGG + Intergenic
1096789326 12:54035126-54035148 CGCCTGCTGCATGCCCTCTCAGG + Exonic
1097621175 12:61941583-61941605 CGCACGGTGCACGCACCCACTGG - Intronic
1103488234 12:121296876-121296898 CGCCCCCTGCGCGCCCCCGCCGG + Intronic
1105741054 13:23323387-23323409 TGTCTGCTGCACGCATTCGCCGG - Intronic
1112344097 13:98576528-98576550 CGGCTCCTGCACGCACACGCCGG + Intronic
1113847686 13:113401904-113401926 CGCCTGCTGAACGCCCTCTCAGG + Intergenic
1116092369 14:40326349-40326371 CGCACGGTGCACGCACCCACTGG - Intergenic
1116314490 14:43370409-43370431 CGCAGGGTGCACGCACCCACTGG - Intergenic
1122582060 14:102777330-102777352 CGCCGGCCCCACGCGCCCGCCGG - Intergenic
1127384969 15:58459924-58459946 AGCCTGCTGCACCCACCAACTGG - Intronic
1127433327 15:58933304-58933326 CTCCGGCTGCCCGCAGCCGCTGG - Intronic
1127547230 15:60003102-60003124 AGCCTGCTGCTCGCACCAGGCGG + Intergenic
1128220290 15:65964147-65964169 TGCCCGCTTCACGCACCAGCTGG - Intronic
1132619351 16:857022-857044 ACCCTGCGGCACGTACCCGCGGG + Intronic
1132750382 16:1454855-1454877 CGGCTGCTGCACGTGCCCCCAGG + Intronic
1132903065 16:2268686-2268708 CGCCTGCCGCGCCCACCCGGTGG - Intergenic
1138180564 16:54937847-54937869 CGGCTGCAGCCCCCACCCGCAGG - Intergenic
1138941895 16:61801596-61801618 CGCATGGTGCACGCACCCACTGG - Intronic
1139890915 16:70252859-70252881 CACCTGCTGCACCCACTCGCTGG + Exonic
1142355759 16:89601039-89601061 CGCCTGCTGCAGGCAGTCCCTGG - Intergenic
1144824491 17:18098173-18098195 CTCCTGCTGCCTGCACCTGCAGG + Intronic
1148467934 17:47875935-47875957 CACCTGCTTCACTCACCCTCAGG - Intergenic
1151856787 17:76727172-76727194 GTGCTGCTGCACGCACCTGCGGG - Exonic
1152689727 17:81712486-81712508 CGCCTGCTGCACGCACCCGCTGG + Exonic
1152700254 17:81815061-81815083 TGCCTGCTGCAGGGACCCCCCGG - Intergenic
1153494574 18:5684811-5684833 CGCACGGTGCACGCACCCACTGG - Intergenic
1154169180 18:12038488-12038510 CGCTGGCAGCACGCACCCACCGG - Intergenic
1154188540 18:12208294-12208316 CGCCCGGTGCGCGCACCCACTGG + Intergenic
1160792633 19:929620-929642 CCCCTGCTGCACCCCCCGGCCGG + Exonic
1160874185 19:1289691-1289713 CGGCTGCTGCCCACACCCGAGGG - Intronic
1161129351 19:2579094-2579116 CCTCTGCTGCAGGCACCGGCGGG - Intronic
1161723479 19:5915940-5915962 CCCCTGCTGCAAGGCCCCGCCGG - Exonic
925276408 2:2651258-2651280 CGCCTGCTGCTTGGACCCGACGG - Intergenic
927156656 2:20224786-20224808 CGCCGGCCGCACTCACCGGCAGG + Exonic
927985779 2:27409488-27409510 CTCCTGCCGCGCGCACCCCCGGG - Exonic
930196372 2:48514785-48514807 CTCCTGCTGCACAGAGCCGCAGG + Exonic
931739340 2:65227996-65228018 CGCCAGCTGCTCGTCCCCGCCGG - Intronic
931773444 2:65519183-65519205 GGCCTGCTGCCTGCACCCTCAGG + Intergenic
934026193 2:88003308-88003330 CGCCTGCTGGGCGCTGCCGCGGG + Intergenic
937293784 2:120797778-120797800 TGCCAGCTGCACGCACCCCAGGG - Intronic
938148979 2:128864851-128864873 CGCCCGGTGCGCGCACCCACTGG + Intergenic
938788587 2:134656409-134656431 CGCACGGTGCACGCACCCACTGG + Intronic
940517243 2:154697952-154697974 CGCCTCCTGCCCTCTCCCGCTGG + Intergenic
941061910 2:160856584-160856606 CGCCCGGTGCGCGCACCCACTGG + Intergenic
944148054 2:196527339-196527361 CGCACGGTGCACGCACCCACTGG + Intronic
944846632 2:203674924-203674946 CCCTTGCTGCACACACCCGCTGG - Intergenic
948469029 2:238165678-238165700 AGCCTGCCGCACTCACCTGCAGG - Exonic
948865977 2:240775041-240775063 CGCCTGCTCCAGGCACACCCAGG - Intronic
1172771769 20:37386316-37386338 CGCCTGCTGCACTCTCGCCCTGG + Intronic
1175546842 20:59783756-59783778 CCCTTGCTGCAGGCACCTGCGGG - Intronic
1176062868 20:63179861-63179883 CGCCTGCTGCAGACACAAGCAGG + Intergenic
1176301795 21:5102136-5102158 CGGCTGCTGGAGGCACCCACGGG - Intergenic
1177810311 21:25918511-25918533 CGCACGGTGCACGCACCCACTGG - Intronic
1179855236 21:44159764-44159786 CGGCTGCTGGAGGCACCCACGGG + Intergenic
1182686528 22:32124388-32124410 CGCCTGGCTCAGGCACCCGCAGG - Intergenic
1183326872 22:37199150-37199172 CGCCAGCCGCACGCCCCAGCAGG - Intronic
1183589529 22:38771782-38771804 CTCCTGCTGGAAGCACCCTCCGG + Intronic
1183663777 22:39235780-39235802 CGCCTGCTGCACGGAGACCCCGG - Exonic
1184717138 22:46288682-46288704 CCCCTGCTGCACTCACAGGCGGG - Intronic
949527220 3:4916678-4916700 CGCACGGTGCACGCACCCACTGG - Intergenic
950864507 3:16178526-16178548 CGCAGGCCGCACGCACCAGCCGG - Intronic
953903977 3:46859043-46859065 CCCCTGCTGCAGGCAGCCGATGG + Intronic
954610495 3:51942372-51942394 GGCCTGCAGCACGCATCTGCCGG - Exonic
955428382 3:58816421-58816443 CGCACGGTGCACGCACCCACTGG - Intronic
963119317 3:141762988-141763010 CGCCCGGTGCGCGCACCCACTGG + Intergenic
964518913 3:157542965-157542987 CGCATGCTGCACGCATCTGCGGG - Intergenic
964960127 3:162411731-162411753 CGCATGGTGCGCGCACCCACTGG + Intergenic
967714321 3:192745079-192745101 CGCCCGGTGCACGCACCCACTGG + Intronic
968897671 4:3414203-3414225 CGCCTGCTGCAGGACCCCGTCGG + Exonic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
970065555 4:12090030-12090052 CGTCTTCTGCACGCTCACGCTGG - Intergenic
972162586 4:36244519-36244541 CGCCTGCTCCCCGCCCCCGCGGG - Intergenic
977960173 4:103076377-103076399 CGCCTTTCGCACGAACCCGCTGG + Exonic
980448780 4:132944552-132944574 CGCCCGGTGCGCGCACCCACTGG - Intergenic
985608459 5:872084-872106 CACCTGCTGCAGGCACCGCCAGG - Intronic
985716179 5:1463293-1463315 CGCCCGGTGCACGCTGCCGCCGG + Exonic
988648456 5:33122514-33122536 CGCCCGGTGCACGCACCCACTGG - Intergenic
1001236541 5:170034549-170034571 CGCCAGCCCCACGCACCAGCAGG - Exonic
1006390761 6:33757017-33757039 CGCCTGCTGCAAGGCCCCTCCGG + Intergenic
1007872944 6:45062591-45062613 CGCATGGTGCGCGCACCCACTGG - Intronic
1009457245 6:63871869-63871891 CTCCTGCTGGAGGCACGCGCAGG + Intronic
1012673600 6:102088341-102088363 CGCACGGTGCACGCACCCACTGG - Intergenic
1012791908 6:103709172-103709194 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1012854778 6:104489536-104489558 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1018354267 6:162995602-162995624 CGCCTGGTGCGTGCACCCACTGG + Intronic
1018533055 6:164787819-164787841 CGCCTGGTGCGTGCACCCACTGG + Intergenic
1021671104 7:23035871-23035893 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1021933170 7:25603164-25603186 CGCATGGTGCGCGCACCCACTGG - Intergenic
1022842219 7:34175426-34175448 CGCACGGTGCACGCACCCACTGG + Intergenic
1023866210 7:44239505-44239527 CCCCTGCTGCACGCAGCCGCTGG - Intronic
1024928176 7:54640260-54640282 CTCCTGCTGGACTCACCTGCCGG - Intergenic
1035697199 8:1607670-1607692 CGCCCGGTGCGCGCACCCACTGG - Intronic
1035741221 8:1929937-1929959 CGCCTGGTCCCCGCAGCCGCTGG + Intronic
1035781178 8:2229369-2229391 GGCCTCCTGCAGGCACCTGCAGG + Intergenic
1036398264 8:8386589-8386611 CGCCTGCCGCTCCCACCCGGCGG + Intergenic
1037146822 8:15582170-15582192 CGCATGGTGCGCGCACCCACTGG + Intronic
1041613240 8:59875662-59875684 CGCATGGTGCACGCACCCACTGG + Intergenic
1042514336 8:69643992-69644014 CGCCTGCCCCACACACCCCCGGG - Intronic
1044101650 8:88148991-88149013 CGCCCGGTGCGCGCACCCACTGG - Intronic
1047203137 8:122782612-122782634 CGCCCGCTGCCTGCAGCCGCCGG - Intronic
1049706683 8:144046326-144046348 CGTCTGCTCCACGCACCACCAGG - Intronic
1051203861 9:14664139-14664161 CGCACGGTGCGCGCACCCGCTGG - Intronic
1051371572 9:16363718-16363740 TGCCTGCTGCAGGCACAGGCAGG - Intergenic
1052846438 9:33340398-33340420 CCCCTGCTGCATGCAGCCTCGGG - Intronic
1053239871 9:36487239-36487261 CGCCTCCGGCCCCCACCCGCGGG + Intronic
1058241696 9:102569914-102569936 CGCCTGCTGTACCCACTCCCTGG - Intergenic
1060695687 9:125707145-125707167 CCCCTGCTGCTCGCCGCCGCCGG + Exonic
1061576074 9:131507400-131507422 CGCCTGCTGCCAGCACTCGCGGG + Exonic
1062453364 9:136624749-136624771 CGACCCCTGCACGAACCCGCTGG + Intergenic
1062665981 9:137672125-137672147 CGCCTGCTGCACGCCCTCTATGG - Intronic
1187421947 X:19142812-19142834 CGCCCGGTGCGCGCACCCACTGG - Intergenic
1187513714 X:19946135-19946157 CGCCCGGTGCGCGCACCCACTGG + Intronic
1188844243 X:35053724-35053746 CACCTTCTGCCCGCACCCCCTGG - Intergenic
1189284278 X:39840496-39840518 GGCCTCCTGCAAGGACCCGCTGG - Intergenic
1190910791 X:54770240-54770262 CGCATGGTGCGCGCACCCACTGG + Intronic
1191981556 X:66930709-66930731 CGCACGGTGCACGCACCCACTGG + Intergenic
1192261833 X:69510317-69510339 TGCCTTCTGCCCGTACCCGCTGG + Intronic