ID: 1152689766

View in Genome Browser
Species Human (GRCh38)
Location 17:81712604-81712626
Sequence CCCCGGGCGCGGCGATCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152689766_1152689773 -1 Left 1152689766 17:81712604-81712626 CCCGGGGATCGCCGCGCCCGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1152689773 17:81712626-81712648 GCTCCCTCCTGGAGAGCGCGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1152689766_1152689779 20 Left 1152689766 17:81712604-81712626 CCCGGGGATCGCCGCGCCCGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1152689779 17:81712647-81712669 GGAGGCCCCCGACGCCCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 125
1152689766_1152689775 2 Left 1152689766 17:81712604-81712626 CCCGGGGATCGCCGCGCCCGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1152689775 17:81712629-81712651 CCCTCCTGGAGAGCGCGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
1152689766_1152689778 16 Left 1152689766 17:81712604-81712626 CCCGGGGATCGCCGCGCCCGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1152689778 17:81712643-81712665 GCGAGGAGGCCCCCGACGCCCGG 0: 1
1: 0
2: 0
3: 14
4: 140
1152689766_1152689784 30 Left 1152689766 17:81712604-81712626 CCCGGGGATCGCCGCGCCCGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1152689784 17:81712657-81712679 GACGCCCGGATGGCCGATCCCGG 0: 1
1: 0
2: 0
3: 4
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152689766 Original CRISPR CCCCGGGCGCGGCGATCCCC GGG (reversed) Intronic
900072108 1:779121-779143 GCCAGGGCCCGGGGATCCCCGGG + Intergenic
900227606 1:1540379-1540401 CCCCGGCCCCGGCGCCCCCCCGG + Intronic
900438404 1:2642001-2642023 CCCAGGGCCCCGCCATCCCCAGG - Intronic
901640913 1:10692572-10692594 TCCCGGGCGCAGAGGTCCCCAGG + Intronic
902985569 1:20152282-20152304 CCCCAGGGGAGGAGATCCCCAGG - Intergenic
905442656 1:38005196-38005218 TCCCGGGCTCGGCGTGCCCCGGG + Intronic
905972691 1:42153631-42153653 CCCCGGGCCCCGTGCTCCCCCGG - Intronic
917846658 1:179025930-179025952 CCCCCGGCCCGGCCATTCCCAGG - Exonic
918870652 1:189969447-189969469 CACCGCGCCCGGCCATCCCCAGG + Intergenic
920071412 1:203305636-203305658 CCACGGCGGCGGCGATCTCCGGG - Exonic
921138790 1:212285878-212285900 CCCGGCGCGCGGCGAGCTCCCGG - Exonic
922267044 1:223993076-223993098 GCCAGGGCCCGGGGATCCCCGGG + Intergenic
1064231004 10:13529114-13529136 GCCCGGCCGCCGCCATCCCCGGG + Intergenic
1070328999 10:75404865-75404887 CCCCGGGCGCGCAGGCCCCCAGG - Intergenic
1071546728 10:86535446-86535468 CCCCGGGCGTGGCGGCCTCCTGG + Intergenic
1071676523 10:87660237-87660259 TCGCGGGCGCGGCGACCCCAAGG - Intronic
1072881433 10:99233138-99233160 CCCCGGACGGAGAGATCCCCAGG + Intronic
1075519811 10:123136657-123136679 CCCCGGGCACGGTGCTTCCCGGG + Intronic
1076877629 10:133224270-133224292 CCCCGGCCGTGGCGATTCCCAGG + Intronic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1080503564 11:32892502-32892524 CCCCGCGCGGGGCGATAGCCAGG + Intergenic
1084888482 11:72224995-72225017 CCCCGGGCCCGGCGCCCCGCAGG - Exonic
1086887859 11:92225074-92225096 CTCCGGGCGAGCCGGTCCCCCGG - Intergenic
1092046232 12:5433220-5433242 ACCCGGGCCCGGCCATCCCAGGG + Intronic
1094048711 12:26195858-26195880 CCACGGTCACGGCGATGCCCAGG - Exonic
1098991196 12:77065931-77065953 CCCCGGGCGCGGCAAGCCGCGGG - Intergenic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1101910489 12:108857400-108857422 GGCCGGGCGCGGCGAGCCCGGGG + Intronic
1103392522 12:120584767-120584789 CCCGGGGCCCGGAGATCCGCTGG + Intergenic
1103433060 12:120904229-120904251 GCCCGAGCGCGGCGCTCCCGCGG - Exonic
1106665515 13:31846966-31846988 TCCCGGGCGCTGCGGTTCCCCGG - Intergenic
1111951472 13:94712210-94712232 CCCGGGGCGCGGCGTGGCCCTGG - Exonic
1111951690 13:94713186-94713208 CCCCGGGCGCGGCGGACTCGCGG - Intergenic
1118836930 14:69484508-69484530 CCCCGGGCCCTGCGACCCGCAGG + Intergenic
1120429703 14:84399431-84399453 AACCGGGCGCGGCGCTCCTCTGG + Intergenic
1122649873 14:103220523-103220545 GACCGGGCGCGGAGAGCCCCTGG + Intergenic
1122707498 14:103629914-103629936 CCCCGCCCGCCGCGATCCCGGGG - Intronic
1122736560 14:103847139-103847161 GCCCGGCCGCGGCGCCCCCCAGG - Intronic
1122863216 14:104591774-104591796 CCCGGGGAGAGGCGAGCCCCTGG - Intronic
1127577666 15:60307803-60307825 CCCCAGGCGTGGAGCTCCCCAGG - Intergenic
1129539676 15:76339834-76339856 CCCAGGGCGAGGCGCTGCCCAGG - Intronic
1130564435 15:84981730-84981752 CCCCGGGGGAGGCGAGCTCCCGG - Intronic
1132586007 16:705975-705997 CCCCGCGCGCGGCGCGCTCCCGG + Intronic
1132765994 16:1534439-1534461 CCCAGGGCTCGGCCCTCCCCGGG - Exonic
1135597334 16:23754668-23754690 CCCCGGGCGCTCCCAACCCCAGG - Exonic
1138681137 16:58684423-58684445 GCCGGGGCGGGGCGATTCCCAGG + Exonic
1139890661 16:70251558-70251580 CCGCCGGCGCCGCGCTCCCCCGG - Exonic
1140046323 16:71442325-71442347 CCCAGGCTGCGGCGTTCCCCAGG + Intergenic
1141959251 16:87393037-87393059 TCCCGGGCGCGGCGAGGCCGGGG - Intronic
1142631559 17:1229348-1229370 CCCCGGGCGCCCCGACCCCGAGG - Intergenic
1145940924 17:28743201-28743223 CCCGGGGCTGGGCGGTCCCCGGG + Exonic
1147723945 17:42554902-42554924 CCCTGAGCTCGGCGATCCTCCGG + Exonic
1148664029 17:49361717-49361739 CCCCGGGCGCTGAGCTCCTCAGG - Intronic
1150675742 17:67245028-67245050 CCCCGGGCGCGGCGGCCCCGGGG - Intronic
1151565202 17:74893700-74893722 CCCCGGGGGCGGGTGTCCCCAGG - Intronic
1152606583 17:81294681-81294703 CCGCGGGCGGGGCGACCCTCTGG - Intronic
1152689766 17:81712604-81712626 CCCCGGGCGCGGCGATCCCCGGG - Intronic
1152736439 17:81999683-81999705 CCCCGGCCTCGGCTGTCCCCTGG + Intronic
1153514480 18:5891335-5891357 CCCCCGCCGCGGCGCCCCCCGGG - Exonic
1153688522 18:7568378-7568400 CTCCGGCGGCGGCGATCTCCCGG + Intronic
1158649442 18:59273031-59273053 CCCCGGGCGCCCCGCTCCGCCGG + Exonic
1158954061 18:62523290-62523312 CCCCGGCCCCGGCCCTCCCCCGG + Exonic
1160023970 18:75204207-75204229 CCCAGGGCGCGCCCATCCCGAGG - Intronic
1160499661 18:79395639-79395661 CCCCGGGCGCCCCCCTCCCCGGG + Intergenic
1160543585 18:79638507-79638529 CCCTGGGCACGGCCAGCCCCGGG - Intergenic
1160847810 19:1174069-1174091 CCCCGGGCGCAGGGGTCCGCGGG + Intronic
1161233295 19:3186266-3186288 ACTCCGGCCCGGCGATCCCCAGG + Intronic
1161323439 19:3651848-3651870 CCCCGCGCGCGGCGCCACCCTGG + Exonic
1161468653 19:4445695-4445717 ACCTGGGCGCGGGGATGCCCCGG + Intronic
1162019753 19:7863064-7863086 CCCCGGCCCCGCCGATCACCTGG - Exonic
1163390279 19:17026652-17026674 CCCCAGGCGCGGCGCCCCCCAGG - Exonic
1164625414 19:29724401-29724423 CTGCGGGCGCGGGGGTCCCCAGG - Intergenic
1165950831 19:39473199-39473221 GCCCGGGCGCCGTGAGCCCCTGG - Exonic
925922257 2:8645675-8645697 CCCCGGGCACGGCGACGTCCTGG + Intergenic
927572872 2:24175199-24175221 CCCTGGGCTCCGCGACCCCCAGG - Intronic
927956522 2:27211391-27211413 CGCCGGGAGCAGGGATCCCCTGG + Intronic
936104810 2:109614780-109614802 CCTCGGGCTCGGCGGTCACCTGG - Exonic
936518803 2:113199002-113199024 GCCCGGGCGCGCCGCCCCCCTGG - Intronic
938406294 2:131035015-131035037 CCCCGGGCGCTGCGGGCCACCGG + Intronic
941808693 2:169734376-169734398 CCCGGGGCGGGGCGGTCTCCGGG + Intronic
942043216 2:172084629-172084651 CCCCATGCGCGGAGAGCCCCGGG - Intergenic
946431193 2:219628040-219628062 CCCCGCGCGCGCCGATCACCTGG - Exonic
948116017 2:235494604-235494626 CCCCGGGCTCGGCGGCCCGCGGG + Exonic
1172073654 20:32277690-32277712 CGGCGGGGGCGGCGAACCCCTGG - Exonic
1172118766 20:32585633-32585655 TCCCGGACGCGGCGGTCCCGCGG + Intronic
1173741711 20:45406601-45406623 CCCAGGGCCCGTCGGTCCCCCGG + Intronic
1173750305 20:45470622-45470644 CCCCGGACCCGGGGACCCCCGGG + Intronic
1174386263 20:50190192-50190214 GCCCGGTCGCGCCGACCCCCGGG + Intergenic
1176555512 21:8252672-8252694 CCGCAGTCGCGGCGGTCCCCCGG - Intergenic
1179581584 21:42347807-42347829 CCCCGGGGGAGGCGGTCCCAGGG - Intronic
1179810368 21:43865666-43865688 TCCCGGGCGCCCCGAACCCCCGG - Intronic
1181646232 22:24232992-24233014 CCCCGGGCACCCCGATCCACTGG + Exonic
1183942034 22:41301462-41301484 CCCCGGGCGCGGCGAGGCGACGG + Intergenic
1183966653 22:41446476-41446498 CCCCTGGCCCGGCGACGCCCGGG - Exonic
954096542 3:48333046-48333068 CCCCTGCCCCGGCGTTCCCCCGG - Intergenic
960914378 3:122681240-122681262 CCCGGGGCGCTGCGGTTCCCCGG + Intronic
961779922 3:129315438-129315460 CCCCGGGCGCGGCCGGCTCCCGG - Exonic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968642545 4:1721735-1721757 CCCCGGCCGCCGCTTTCCCCGGG + Intronic
968662815 4:1805803-1805825 CTGCGGGCGCGGCGGCCCCCGGG + Exonic
968756469 4:2418669-2418691 CCTAGGGCGCCGCGAGCCCCGGG + Intergenic
986506527 5:8457774-8457796 CTCCGGAGGCTGCGATCCCCGGG + Intergenic
991587468 5:68215523-68215545 CCCCAGCCGCGGGGATGCCCCGG - Intergenic
1001496018 5:172188201-172188223 CTCCCGGCGCGGCGCTGCCCAGG - Exonic
1002088838 5:176792806-176792828 CCCCAGGCCTGGCCATCCCCAGG - Intergenic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1003078165 6:3000187-3000209 GCCCGGGCGCGACGACCCACAGG - Intronic
1008691203 6:53981442-53981464 CCCCGGGTCAGGCCATCCCCTGG + Intronic
1010428141 6:75749064-75749086 CCGCGGGCGGGGCGACCCCGGGG + Intergenic
1011734170 6:90296044-90296066 CCCCCGGCCCGGCGAGGCCCGGG - Intronic
1013366246 6:109440582-109440604 CCCCGGGCGCGGCCATGGCAAGG - Exonic
1013793688 6:113860432-113860454 CGCCGGGCCCGGCGCGCCCCCGG + Exonic
1015999608 6:139029367-139029389 CCCCGGGCTCCACGAGCCCCTGG - Intronic
1019213298 6:170423341-170423363 CCCCGCGCCCGGCGAAACCCTGG + Intergenic
1019298069 7:289641-289663 TTCCGGGCGCCGGGATCCCCGGG - Intergenic
1019475421 7:1241815-1241837 CGCCGGGCGCGGGGAGACCCCGG - Intergenic
1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG + Intergenic
1020560570 7:9726209-9726231 CCCCAGGCGCGGCGCCCCCCAGG + Intergenic
1021678545 7:23105983-23106005 CGCCCGGCCCGGCGAGCCCCGGG + Exonic
1022095690 7:27139681-27139703 CCCAGGGCTCCGCGACCCCCAGG + Intronic
1022097098 7:27147923-27147945 CCTCGGTCGCCGCGGTCCCCGGG - Intronic
1027374438 7:77536888-77536910 CCCCGGGCGGGGCCACGCCCCGG + Intergenic
1029413677 7:100430327-100430349 CCCGGGGCGAGCCGCTCCCCCGG + Exonic
1031531992 7:122886640-122886662 CCCCGGGCGCGCCGACCCAGCGG + Intronic
1041429698 8:57765572-57765594 CCCCGGTCGGGGTGATCCCAGGG + Intergenic
1044666753 8:94640528-94640550 CCCGGGGCGCGGAGCTGCCCAGG - Intergenic
1044692871 8:94896180-94896202 CCCTGAGCGCGGTGGTCCCCGGG + Intronic
1048970163 8:139641035-139641057 CCCTGGGCAGGGCGATTCCCTGG - Intronic
1049621105 8:143598667-143598689 CCCCGGGCGCAGGGGACCCCGGG + Exonic
1057054426 9:91949937-91949959 CCCGGGGCTCGGCGCTCCCGCGG - Exonic
1057054427 9:91949937-91949959 CCGCGGGAGCGCCGAGCCCCGGG + Exonic
1059176600 9:112174794-112174816 CCCCGGGCGCCGCCCTGCCCGGG + Intronic
1061038900 9:128128432-128128454 CGCCGGGCGGGGCCATCCCGGGG - Exonic
1062499117 9:136844791-136844813 CTCCCGGCGCGGCGATGCCTCGG - Exonic
1203731803 Un_GL000216v2:98567-98589 CCCCAGGCCCGGCGATGCCCGGG + Intergenic
1185894005 X:3842992-3843014 CCCCAGGCGAGGTGATCCACAGG + Intronic
1192624612 X:72714347-72714369 CCCCGGGGCGGGCGAGCCCCGGG - Intergenic
1198800150 X:140439786-140439808 CCCCGGGCTGGGCGATCACAGGG + Intergenic