ID: 1152690168

View in Genome Browser
Species Human (GRCh38)
Location 17:81714325-81714347
Sequence GTGGTGGAGGCCAACAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152690154_1152690168 30 Left 1152690154 17:81714272-81714294 CCCTACTGCCGGGAGCTCTCAGC 0: 1
1: 0
2: 2
3: 9
4: 101
Right 1152690168 17:81714325-81714347 GTGGTGGAGGCCAACAGAATGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1152690157_1152690168 22 Left 1152690157 17:81714280-81714302 CCGGGAGCTCTCAGCTGGCCAGG 0: 1
1: 0
2: 3
3: 40
4: 410
Right 1152690168 17:81714325-81714347 GTGGTGGAGGCCAACAGAATGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1152690162_1152690168 4 Left 1152690162 17:81714298-81714320 CCAGGCGAGGAGGCAGAGGTCCT 0: 1
1: 0
2: 1
3: 28
4: 264
Right 1152690168 17:81714325-81714347 GTGGTGGAGGCCAACAGAATGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1152690155_1152690168 29 Left 1152690155 17:81714273-81714295 CCTACTGCCGGGAGCTCTCAGCT 0: 1
1: 0
2: 0
3: 6
4: 140
Right 1152690168 17:81714325-81714347 GTGGTGGAGGCCAACAGAATGGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152690168 Original CRISPR GTGGTGGAGGCCAACAGAAT GGG Intronic
904853365 1:33476244-33476266 GAGAGGGAGGCCAACAGAGTCGG - Intronic
905178534 1:36152973-36152995 CTGGGGGAAGCCCACAGAATGGG - Intronic
906086627 1:43140998-43141020 GGGCTGGAGGCCAAGTGAATTGG + Intergenic
908923717 1:69227240-69227262 GTGGTAGTGGCTAACAGATTGGG - Intergenic
909469410 1:76010096-76010118 GAGGTTGAGACCAACAGAACGGG + Intergenic
909522312 1:76583952-76583974 GTGGTGGTGAGGAACAGAATTGG - Intronic
911960989 1:104301921-104301943 GTGGTGGAGGCCACTGGAAGAGG + Intergenic
913315722 1:117549709-117549731 GTGGCGGAGGCCAGAAGAATGGG + Intergenic
916581163 1:166110471-166110493 GTGGCTGAGGCCAACACAAGTGG + Intronic
918107225 1:181425446-181425468 GTGGAGGAGGTGAACATAATTGG + Intronic
918258415 1:182771223-182771245 GTGAGGGTGGGCAACAGAATTGG + Intergenic
919843191 1:201623746-201623768 TAGGTGGAGGCCTACAGAGTTGG + Intronic
921190537 1:212704221-212704243 GGGGTGGAGGCCAAGAGATGAGG + Intergenic
922209256 1:223474968-223474990 GTGGTGGAGGCCACATGAAAGGG - Intergenic
923514309 1:234681652-234681674 GGGGTGGAGAGCAACAGCATTGG + Intergenic
1063684522 10:8224173-8224195 GTGGTGTAAGCCAAAAGCATTGG + Intergenic
1068170743 10:53390860-53390882 GGGGTGGAGGCGAACAGCTTGGG - Intergenic
1071197249 10:83175704-83175726 GTGATGGATGCAAGCAGAATTGG + Intergenic
1071660817 10:87500800-87500822 GCAGTGGAAGCCAACAGAAGAGG - Intergenic
1074820399 10:117174140-117174162 GTGGGGGAGGCAGAGAGAATTGG - Intergenic
1078545662 11:12245422-12245444 GAGGTGGAGGCCAACAGGGGTGG - Intronic
1079451069 11:20600083-20600105 GCGGTGGAGGCGAAGATAATAGG + Intronic
1080798639 11:35589162-35589184 TTGGTGAAGGCCAACAGAACAGG - Intergenic
1085175828 11:74487322-74487344 GTGGTGCAGGGACACAGAATGGG - Intergenic
1086905290 11:92411642-92411664 GTGGGAGGGGCCGACAGAATAGG + Intronic
1087073384 11:94104355-94104377 GTGATGGTGGTCAACAGGATGGG + Intronic
1088787003 11:113191131-113191153 GTGGTGGATGCCAACAGGGATGG - Intronic
1089392395 11:118111135-118111157 GTGGTGGCTGCCAGAAGAATTGG + Intronic
1089762155 11:120735794-120735816 GTGGTGGAGGCCATGAGGAAAGG - Intronic
1090515628 11:127423618-127423640 GTGGTGGTGGCCACCAGGATAGG - Intergenic
1091974112 12:4811015-4811037 GTGGAGGAGGCGGCCAGAATGGG + Exonic
1092002801 12:5045295-5045317 GTGGAGGAGGCGGCCAGAATGGG + Exonic
1096513199 12:52143265-52143287 CTGGTGGAGGCCAGCAGGAGGGG - Intergenic
1101281218 12:103258456-103258478 GTGGTCCAAGCCAACACAATAGG + Intronic
1101832776 12:108272275-108272297 CTGGTGGAGCAGAACAGAATTGG + Intergenic
1103887247 12:124211847-124211869 GTGATGGAGGCCAAGTGACTGGG - Intronic
1104759736 12:131289698-131289720 GTGATGGAAGCCAACAGAAGGGG - Intergenic
1105356454 13:19663949-19663971 GTGGTCCAGGCCATCAGAAGAGG - Intronic
1106663040 13:31822522-31822544 GTGTTGGAAGTCAAGAGAATTGG - Intergenic
1111142459 13:84137505-84137527 GTGGTCGAGGCCAACGTATTTGG + Intergenic
1111570313 13:90075725-90075747 GTGGTGGAGACTGACAGCATGGG - Intergenic
1113357497 13:109596136-109596158 GTGGTGGAGGCCAAGAGCTTTGG - Intergenic
1116457232 14:45134060-45134082 GGGGTGGAGGCCAGAAAAATAGG - Intronic
1117794479 14:59377926-59377948 TTGGTGCAAGACAACAGAATAGG - Intergenic
1119220713 14:72904847-72904869 GTGGTGGATGACAGCAGGATGGG + Intergenic
1120301962 14:82719280-82719302 GCAGTGGAGCCCACCAGAATGGG - Intergenic
1123422820 15:20145495-20145517 CTGGTGGCGGTCAACAGAGTTGG - Intergenic
1123532045 15:21152035-21152057 CTGGTGGCGGTCAACAGAGTTGG - Intergenic
1124269609 15:28268542-28268564 GTAGTGGTGACCATCAGAATGGG + Exonic
1128380363 15:67107698-67107720 GTGGGTGAGGGCAACAGTATGGG - Intronic
1130550599 15:84888008-84888030 GTTGAGGAGGCCAACACACTGGG - Intronic
1131266772 15:90920121-90920143 GTGGTGGAAGCAGACAGAAGAGG + Exonic
1131684959 15:94758319-94758341 GTGGTGGCGGCCACCACAAGCGG - Intergenic
1135594002 16:23727640-23727662 GTGGTGGCGGCCATCTGTATCGG - Intergenic
1138154791 16:54693192-54693214 GTGGTGGAGGGAAAGAGCATGGG - Intergenic
1138588465 16:57986180-57986202 CTGGAGGAGGCCAAAAGGATAGG + Intronic
1141627704 16:85270038-85270060 GGGGTGGAGTCCAGCAGACTTGG - Intergenic
1143302915 17:5924296-5924318 GTGGTTAAGTCCAACAGACTGGG - Intronic
1143476501 17:7206426-7206448 GTGTTGGAGGCCATAAGCATGGG - Intronic
1143548983 17:7617212-7617234 ATGGTGGAGACAAACAGACTTGG + Intronic
1147169827 17:38611455-38611477 GGGGAGGGGGCAAACAGAATTGG + Intergenic
1147757014 17:42775427-42775449 GTGGCGGAGGCCAGAAGAATGGG + Exonic
1148770575 17:50063818-50063840 GTGATGGAGGCCAGCAGAAGAGG - Intronic
1151173627 17:72269021-72269043 GTAGTGGAGGCCAAGAGTAGAGG - Intergenic
1152498437 17:80691952-80691974 GTGGTGCAGGATAAGAGAATGGG - Intronic
1152655656 17:81518107-81518129 GTGCTGGAGGCCCACAGAGTGGG + Intronic
1152690168 17:81714325-81714347 GTGGTGGAGGCCAACAGAATGGG + Intronic
1156368120 18:36448421-36448443 CTGGTGGGGGCCTGCAGAATAGG - Intronic
1160029045 18:75242895-75242917 GGGGTGGAGGAAGACAGAATTGG - Intronic
1162620980 19:11844126-11844148 GTGTTGGAGGCTGAAAGAATGGG - Intergenic
1162728958 19:12706205-12706227 GAGGTGGTGGCCTACAGAGTCGG + Exonic
1163544109 19:17930821-17930843 GTTGTGGAGGCCCACAGCCTGGG - Intergenic
1166375073 19:42323480-42323502 GTGGTGGATGTCAACTGAAAGGG + Intronic
1167381621 19:49141646-49141668 GTGGTGGTGGTGAACAGAAATGG + Intronic
1167492604 19:49801157-49801179 GGGGTGGAGGCCGAGAGGATGGG - Intronic
1168556023 19:57340680-57340702 ATGGTTGAGTCCCACAGAATGGG - Intergenic
925315992 2:2923767-2923789 ATGGTAGATGCCAACAGTATGGG - Intergenic
927926924 2:27020011-27020033 CTGGGGGAGGACAAGAGAATTGG + Intronic
927975631 2:27336144-27336166 GTGGTTGAGGACAGCAGGATGGG - Intronic
928721880 2:34130465-34130487 GTGGTGGGGGCGAACAGATAGGG + Intergenic
932238668 2:70141135-70141157 GTAGCGGTGGCCAAGAGAATGGG + Intergenic
941068401 2:160928885-160928907 GTGGTTGTGGAAAACAGAATGGG - Intergenic
946761127 2:222994218-222994240 GTGCTGAAAGTCAACAGAATGGG - Intergenic
948349303 2:237325037-237325059 ATGGTGCAGGGCAAAAGAATGGG - Intronic
1171177143 20:23060971-23060993 CTGGTGGAGCCCCACAAAATCGG + Intergenic
1171431330 20:25084738-25084760 GTCCTGGCGGCCAAAAGAATGGG + Intergenic
1172513583 20:35517067-35517089 GGGATGGAGGCCAACAGGAGAGG - Exonic
1173018517 20:39248116-39248138 GAGGTGGAAGCCAATAGAAGAGG + Intergenic
1173447025 20:43128476-43128498 CTGGGGCAGGCCAAAAGAATGGG - Intronic
1176222038 20:63974336-63974358 GTGGTGGGGGCTTACAGGATGGG + Exonic
1176966013 21:15212561-15212583 ATGTTGGAGTCCAACAGACTTGG + Intergenic
1178285543 21:31322579-31322601 GTTGTTGAGGCCAAGAGACTGGG - Intronic
1180223586 21:46375788-46375810 GTGGTGGAGGCCAAATGAGGCGG - Intronic
1181496154 22:23288559-23288581 ATGGGGGAGGCCAAGAAAATGGG - Intronic
1183340188 22:37275868-37275890 ATGGTGGAGGCCAACGCCATGGG - Intergenic
1185108364 22:48886845-48886867 GTGGAGGAGGTCACCCGAATGGG - Intergenic
951279494 3:20731309-20731331 GTGGTGGTGGCCAAGGGAAGAGG - Intergenic
953420897 3:42752396-42752418 CTGTTGGAGGGCAACAGAATTGG + Intronic
953983395 3:47424081-47424103 GTGGTGGTTCCCAACAGACTGGG + Intronic
954092246 3:48294519-48294541 GTGGTGGTGCCCAGCAGAAATGG + Exonic
957217657 3:77342700-77342722 GTGGGGGATGCCAACAAAAATGG - Intronic
960569460 3:119171345-119171367 GTGGGGATGGCCAACAGAAAGGG + Intronic
960870075 3:122239299-122239321 GTGGTGGTGGCCACCAGGAGGGG + Intronic
965555356 3:170012791-170012813 GAAATGGAGGCAAACAGAATAGG + Intergenic
965685224 3:171295432-171295454 GTGGTGGAGGTCTACTGAAATGG - Intronic
974402295 4:61423603-61423625 TAGGTGGAGGCCAACGGATTAGG + Intronic
975026804 4:69559130-69559152 GTGGTGGTGGCCATCATAAGAGG + Intergenic
975883057 4:78933841-78933863 GTGGTGAAGGCATAAAGAATAGG + Intronic
976559430 4:86484457-86484479 GTTATGGAGGCCAACTGACTAGG + Intronic
979077710 4:116295342-116295364 GTGGAGGAAGTCCACAGAATTGG + Intergenic
983480234 4:168264805-168264827 GTAGTGGAGAACAACTGAATTGG - Intronic
986041855 5:4001304-4001326 GTGGTGGGGGCCACCAGCACCGG - Intergenic
986409599 5:7464210-7464232 GTGCTGGAGGACAACAGGAAAGG - Intronic
987872021 5:23631619-23631641 AGGGTGGAGCCCACCAGAATGGG - Intergenic
990878394 5:60512963-60512985 GTGGTGGAAGTCAACAGAGCAGG + Intronic
998712496 5:144842832-144842854 TTGGTTGATGCCAACAGACTAGG + Intergenic
999149216 5:149415691-149415713 CTGCAGGAGGCCAACAGCATTGG - Intergenic
1004597954 6:17118769-17118791 GTGTTGGAGCCAAACAGACTTGG + Intronic
1006573700 6:35027177-35027199 GTGAGGGAGGCCAACTGATTGGG + Intronic
1007082361 6:39116772-39116794 GTGATGGAGGTCACGAGAATTGG + Intergenic
1015029684 6:128580195-128580217 GTGGTGGAGGACGACAAAGTGGG - Intergenic
1016605910 6:145925943-145925965 CTGTTGGTAGCCAACAGAATGGG - Intronic
1017542784 6:155420160-155420182 GTGGTGGAGGTTAAGAGAAGGGG + Intronic
1026922961 7:74169951-74169973 GTGCTGGAGACCAAAAGAAGGGG + Intergenic
1029114217 7:98229113-98229135 ATGGTGGAGGCCAACAGCCGGGG - Exonic
1030297384 7:107942400-107942422 GTGGTGAGGGCCAAATGAATGGG - Intronic
1031963191 7:128008123-128008145 GTGATGGAGGCAGACAGAAGAGG + Intronic
1032472920 7:132191244-132191266 GTTGTGATGGCAAACAGAATGGG + Intronic
1032663586 7:134012827-134012849 GAGGAGGCAGCCAACAGAATAGG + Intronic
1034145883 7:148871154-148871176 TTGGTAGTGGCCAACATAATGGG - Intronic
1035170408 7:157014296-157014318 GTGGTGGGGGCCAGCTGATTAGG - Intergenic
1037419159 8:18683716-18683738 GTGTGGCAGGGCAACAGAATTGG - Intronic
1037509090 8:19563562-19563584 GTGATGGTGACCATCAGAATGGG - Intronic
1038023956 8:23572778-23572800 GTGGTGGAGCCCAGTAGAATTGG + Exonic
1042575578 8:70215206-70215228 GTGGTGGAGGGGGTCAGAATGGG - Intronic
1042867094 8:73365749-73365771 GTGGCGGAGGCCAACAGAGGTGG + Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1044095689 8:88061324-88061346 GAGGTATAGGCCAACAGAAGAGG - Intronic
1047343299 8:124003289-124003311 GTGGTGGAGGCCATAGGAATGGG - Exonic
1048106166 8:131412391-131412413 GTGATGCTGGCCAATAGAATAGG - Intergenic
1049680176 8:143914692-143914714 GTGGTGGAGGCCCTCATACTAGG + Intergenic
1057263451 9:93598888-93598910 GGTGTGGAGGCCAACAGGAAGGG - Intronic
1058345067 9:103951234-103951256 AGGGTTGAGGCCAACAGAAGTGG - Intergenic
1059667760 9:116465131-116465153 GTGGTGGAGGCAGACAGACTTGG - Intronic
1190989876 X:55536150-55536172 CTGGGAGAGGCCAACAGATTGGG + Intergenic
1191034016 X:56005985-56006007 CTGGCGGAGGCCAACAGACAGGG + Intergenic
1192048225 X:67699070-67699092 GTGGTGTAGGGCAAAAGAATAGG - Intronic
1192331417 X:70178229-70178251 GTGGTGGTGGCTTACAGAGTTGG + Intronic
1197439374 X:126471320-126471342 GTGGTGGTGGCCATGAGAGTGGG + Intergenic
1199519515 X:148719725-148719747 ATGGTGCAGGCCAACAACATGGG + Intronic
1200134168 X:153866872-153866894 CTGGAGGAGGCCAGCAGAAGAGG + Intronic