ID: 1152690236

View in Genome Browser
Species Human (GRCh38)
Location 17:81714664-81714686
Sequence CCTCATCTGCAGAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 455}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152690230_1152690236 11 Left 1152690230 17:81714630-81714652 CCAGCGGGTGCGTTACCTCTCCA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG 0: 1
1: 0
2: 7
3: 46
4: 455
1152690231_1152690236 -4 Left 1152690231 17:81714645-81714667 CCTCTCCATGCCTCAGTTTCCTC 0: 18
1: 152
2: 872
3: 3064
4: 6954
Right 1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG 0: 1
1: 0
2: 7
3: 46
4: 455
1152690229_1152690236 21 Left 1152690229 17:81714620-81714642 CCTGATGGCACCAGCGGGTGCGT 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG 0: 1
1: 0
2: 7
3: 46
4: 455
1152690232_1152690236 -9 Left 1152690232 17:81714650-81714672 CCATGCCTCAGTTTCCTCATCTG 0: 67
1: 379
2: 1116
3: 2190
4: 3586
Right 1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG 0: 1
1: 0
2: 7
3: 46
4: 455
1152690225_1152690236 28 Left 1152690225 17:81714613-81714635 CCCAAATCCTGATGGCACCAGCG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG 0: 1
1: 0
2: 7
3: 46
4: 455
1152690226_1152690236 27 Left 1152690226 17:81714614-81714636 CCAAATCCTGATGGCACCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG 0: 1
1: 0
2: 7
3: 46
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152690236 Original CRISPR CCTCATCTGCAGAAGGAGAA TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901826909 1:11868018-11868040 AGTCATCTTCAGAAAGAGAAAGG - Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902971304 1:20053707-20053729 CTAAATCTGCAGGAGGAGAAGGG - Intronic
903260783 1:22130666-22130688 CCTCATCTGTAGTAAGAGAAGGG + Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
903882646 1:26522053-26522075 CCTCATCTGAGGAATGGGAATGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
903993631 1:27290784-27290806 CCTCATCTGTAAAAGGAAAGAGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904537161 1:31207481-31207503 ACTCATGTACTGAAGGAGAAAGG + Intronic
904921566 1:34012188-34012210 CCTGATCTGCTGGAGGAGCAAGG - Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905490996 1:38343673-38343695 CCTCAGCTGCAGAAGCAAAGAGG + Intergenic
905707567 1:40073057-40073079 GTTGATCTCCAGAAGGAGAAAGG + Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905929378 1:41776529-41776551 CTTCACCTGCATAAGGACAAAGG - Intronic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907758380 1:57333367-57333389 CCTCATCTCCGACAGGAGAATGG + Intronic
908439662 1:64141303-64141325 CAGCTTCTGCAGAAGGTGAACGG + Intronic
910349757 1:86281804-86281826 CCTCAGTCTCAGAAGGAGAAAGG + Intergenic
912963381 1:114215930-114215952 CCTCTCCTGCAGGAGGAGATAGG - Intergenic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
918639606 1:186823731-186823753 CATCATCTGCAAAAGGAAAGAGG + Intergenic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
919750181 1:201032907-201032929 CCTCATCTGTAGAACAATAATGG - Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
921407755 1:214799597-214799619 CTGCATCTGCAGCAGTAGAAGGG + Intergenic
921600063 1:217097213-217097235 CCTCATGGGTTGAAGGAGAAGGG - Intronic
922183749 1:223256494-223256516 AGTCATCTGCAGGAGGAGAGCGG - Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
1062902984 10:1159627-1159649 CCTCATCTGCATAAAGCGTAGGG - Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1064257735 10:13758569-13758591 CCACATGTGCACTAGGAGAAGGG + Intronic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1067708972 10:48633767-48633789 ATCCATCTGCAGAAGGAGATGGG + Intronic
1067775259 10:49159989-49160011 CCTCAACAAAAGAAGGAGAAAGG + Intronic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG + Intergenic
1070306213 10:75240665-75240687 CCTCATCTGGAGAGGCTGAATGG + Intergenic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070963552 10:80515893-80515915 CCACATCTGGAGAAAGAGAAGGG - Intronic
1071792201 10:88966699-88966721 CCTCATCTGCAAAATGACAATGG + Intronic
1073300486 10:102468270-102468292 CCTCTTCTGCAAAAGGTAAAAGG - Intronic
1073880757 10:107976773-107976795 CCTCATCTTAAGAATGAAAAAGG - Intergenic
1074037363 10:109753832-109753854 CATCAGCTGCAGAAGTAGAAGGG + Intergenic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074289154 10:112125323-112125345 CCTTATCAGCAGAATGAGACTGG - Intergenic
1074415246 10:113261814-113261836 ACTCATCTGCAGAAGTCGCAAGG - Intergenic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1074881587 10:117663573-117663595 CCCCATCTGGAAAAGGTGAATGG + Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075462922 10:122630739-122630761 CCTCACCTCCAGACGGAGAGGGG - Intronic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076269228 10:129136314-129136336 CCCCCTCTGCAGAGGAAGAAAGG - Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079613989 11:22467940-22467962 CACCATCTGCACAAGGAGACAGG + Intergenic
1080036337 11:27715791-27715813 CCTCATCTGTAAAAGGTGATTGG + Intronic
1080576830 11:33607469-33607491 CTTCATCTTCAGCAGCAGAATGG + Intronic
1080609992 11:33895548-33895570 CCTCATCTGCAGATGAAAAGTGG - Intergenic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1084769239 11:71331930-71331952 CCCCTCCTGTAGAAGGAGAATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085637631 11:78170647-78170669 CCACAGCTGCACAAGGGGAAGGG - Intergenic
1085638376 11:78175380-78175402 CCTCATCTGCACAACAGGAATGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086867304 11:91995701-91995723 CGTCATCCACAGAAAGAGAAAGG + Intergenic
1086911671 11:92479573-92479595 CCTTATCTACAGAGGCAGAATGG - Intronic
1087298114 11:96400728-96400750 CCACATGAGCAGAAGGTGAAAGG - Intronic
1089086085 11:115818022-115818044 CCTCCTCTGGAGCAGGGGAAGGG + Intergenic
1089130317 11:116207218-116207240 CCTCCACTGCAGAACGAGCATGG + Intergenic
1089315853 11:117590789-117590811 CCTCAAATGCAGACTGAGAATGG + Intronic
1089446522 11:118557148-118557170 CCTCGTCACCAGAAAGAGAAGGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089721266 11:120425158-120425180 TCCCATCTGCACAGGGAGAAGGG + Intronic
1089773854 11:120822331-120822353 CCTCAGCTAGAGAAGAAGAAAGG + Intronic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090383277 11:126341862-126341884 GCTCATCTGCAGAAGGTCTAAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090455906 11:126849607-126849629 AATCAGCTGCAGAAGGAGAAAGG + Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096677643 12:53234133-53234155 GCCCCTCTACAGAAGGAGAAGGG - Intergenic
1096792471 12:54053610-54053632 CCTCCCCTGCAAAAGGAGATGGG - Intronic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1100000856 12:89833429-89833451 CCTCATCTGCAAAAGAAAAGAGG - Intergenic
1100255569 12:92879820-92879842 CCTTATCTGTGGGAGGAGAATGG - Intronic
1100361910 12:93886963-93886985 TCTCTTCTGCAGAATCAGAATGG - Intronic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101595537 12:106161304-106161326 CATGGTCTGCAAAAGGAGAAAGG + Intergenic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103038465 12:117675364-117675386 CCTGATTTGCAGATGGAGACTGG - Intronic
1104586760 12:130053908-130053930 CCTCTTCTGTGGCAGGAGAAAGG - Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1106881606 13:34138070-34138092 CCTCATCAGCAGAGGCAGACAGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107631952 13:42351423-42351445 CCCCCTATGCAGAGGGAGAAGGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1109355961 13:61230206-61230228 CCTAATATCCAGAAGGAGAGAGG - Intergenic
1114187950 14:20417406-20417428 CCTCAGCTCCAGAAGTAGCAAGG - Intergenic
1115344045 14:32323273-32323295 AATCTTATGCAGAAGGAGAAAGG - Intergenic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120132237 14:80821809-80821831 CTTTATCTGCAGTGGGAGAATGG - Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1122138518 14:99648328-99648350 CCTCATCTGTGGAAGGGGAAAGG - Intronic
1124375844 15:29128210-29128232 CCTTAGCAGCAGAGGGAGAAAGG - Intronic
1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG + Intergenic
1127060403 15:55177037-55177059 TCTCATCTGCACAATAAGAAGGG + Intergenic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1127385130 15:58460873-58460895 TCTCATCTGCAAGAGGACAATGG + Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129342980 15:74898131-74898153 CCTCAGCTGCAGAGGAGGAAAGG + Exonic
1130741740 15:86608179-86608201 CCTGAACTGCAGGATGAGAAAGG - Intronic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1131367118 15:91851131-91851153 CCTCATGTACAGACTGAGAAGGG - Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131941576 15:97572455-97572477 CATCATCTGCTAAAAGAGAATGG - Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1132592892 16:734053-734075 CCTCTGCTGCAGAAGAGGAAGGG + Intronic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1133777186 16:8905980-8906002 CCTCATCTGCCAAATGAGTATGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134161634 16:11895121-11895143 GCTCATTTTCAAAAGGAGAAGGG - Intronic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1136369355 16:29826251-29826273 CCTCATCTACAAAATGAGAATGG - Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1137760666 16:50937581-50937603 CTTCATCAGCAGCAGGAAAACGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138354604 16:56367199-56367221 CCTCATGTGCTGGAAGAGAAAGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138898482 16:61239810-61239832 CCTCATTTCCAAAAGGAGTAGGG - Intergenic
1139601484 16:67990121-67990143 CCGCCCCTGCAGAAGAAGAACGG - Exonic
1140132848 16:72179176-72179198 CCTGCTCTCCAGCAGGAGAAGGG + Intergenic
1140622400 16:76751427-76751449 AGTGAACTGCAGAAGGAGAAGGG + Intergenic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1143141289 17:4743286-4743308 TCACCTCTGGAGAAGGAGAAGGG - Exonic
1143376403 17:6470184-6470206 CCTCCTCTCCAGCTGGAGAAGGG + Intronic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1144064289 17:11610877-11610899 CCTCAGCTGCTCAAGGAGAAGGG - Intronic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1144669065 17:17121596-17121618 CCCCATCGGCAGCAGGGGAAGGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146957117 17:36942347-36942369 CCACCTCCGTAGAAGGAGAAGGG - Exonic
1148136952 17:45299509-45299531 CCTCAGGCGGAGAAGGAGAATGG + Intronic
1148733253 17:49850646-49850668 CCCCATCTGCATCAGGAGAATGG - Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149142363 17:53447773-53447795 GGTCATCGGCAGAAGGTGAAGGG + Intergenic
1150143775 17:62751291-62751313 CCTCACCTGCAAAACGAGACGGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151362664 17:73597984-73598006 TCCCATCTGTAGAAGTAGAAAGG - Intronic
1151747527 17:76019312-76019334 CCTCATTTGCAGTGGGACAAGGG - Intronic
1152215206 17:79027962-79027984 CCCCATCTGAAGCTGGAGAACGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152915808 17:83034882-83034904 CCTCATCAGCAGCATGAAAACGG + Intronic
1152930548 17:83107527-83107549 CCCTCTCTCCAGAAGGAGAAGGG - Intergenic
1153122798 18:1750833-1750855 CCTTATCTATAGAAGGACAAAGG + Intergenic
1153843119 18:9024582-9024604 GCTCAGATGCAGAAGTAGAATGG + Intergenic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1155714104 18:28918521-28918543 CCTGAACTTCAGAATGAGAACGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156634625 18:39012336-39012358 TCCCATCTTCAAAAGGAGAAGGG - Intergenic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1159061085 18:63514517-63514539 TCTCAGCTGCAGCAGGAGAGGGG - Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159116827 18:64123970-64123992 CCTCACCTCCAAAAGCAGAAGGG - Intergenic
1160421708 18:78752109-78752131 TCTCATGTGCGGAAGCAGAATGG - Intergenic
1160842897 19:1154397-1154419 CATGATCTGCAGAGGGAGACGGG + Exonic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG + Intronic
1163800015 19:19358979-19359001 CCTCATATGCTGATGGAGCATGG - Intergenic
1164541165 19:29122501-29122523 CTTCTTCTCCAGAAGGAGAGGGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1165106214 19:33471007-33471029 CGTAATCTGCCAAAGGAGAAAGG + Intronic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1166063906 19:40345391-40345413 CCTCAACTGCACAATAAGAATGG + Intronic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166655502 19:44608332-44608354 CCTTTTCTGCAATAGGAGAACGG + Intergenic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1168148155 19:54430796-54430818 CAGCCTCTGCAGAAAGAGAAAGG - Exonic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
926758323 2:16253488-16253510 CCTCATCAGCAGGTGGAGACCGG + Intergenic
927905863 2:26855786-26855808 CTTGCTCTGCAGAAGGACAAAGG - Intronic
928198284 2:29230393-29230415 CATCATCTGCTGCAGCAGAAAGG - Intronic
928691589 2:33805051-33805073 CCTTACCAGAAGAAGGAGAAAGG + Intergenic
929588521 2:43130830-43130852 CCCCCTCTGCACAAGGAGAGAGG + Intergenic
929611949 2:43277221-43277243 CATTACCTGCAGAAGGAGATCGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930031482 2:47060752-47060774 GCTCAGCTGCAAAAGCAGAAGGG - Exonic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932639483 2:73429067-73429089 CCTGATCTGCATAAGGAAATAGG + Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
934157229 2:89214740-89214762 CCTCAGCTTCTGAAGGGGAATGG - Intergenic
934210085 2:89968004-89968026 CCTCAGCTTCTGAAGGGGAATGG + Intergenic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935501023 2:103838946-103838968 CTTCAACTTCATAAGGAGAAGGG - Intergenic
937145179 2:119638520-119638542 CCACAGCTGCAGAACAAGAATGG + Intronic
937244321 2:120482854-120482876 CATCACCTCCAGCAGGAGAATGG - Intergenic
937342369 2:121099448-121099470 CCTCACCTGCAGACGGAACAGGG - Intergenic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
940372128 2:152915200-152915222 CCTCATCTATAGAAGGGCAAAGG - Intergenic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946968801 2:225068777-225068799 CTTCATCTGCAGCATGAAAACGG + Intergenic
947010824 2:225564486-225564508 CCTCATCTGAATATAGAGAAAGG + Intronic
948084163 2:235232533-235232555 CCTGATCTGGAGCAGGAGAGCGG + Intergenic
948447064 2:238041001-238041023 CCCCATCTGGAAAATGAGAAGGG + Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1169653214 20:7892952-7892974 CCTGAACTGCAGAAGGACAGAGG - Intronic
1170534297 20:17324808-17324830 CAGCATCTGCAGAAGGAAATGGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172936610 20:38624992-38625014 CCTCATCTGCTGAACAAGTAAGG - Intronic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174794906 20:53513909-53513931 TCTAATCAGCAGAAAGAGAATGG - Intergenic
1174817015 20:53695969-53695991 CCTCATCTGTGGGATGAGAATGG - Intergenic
1175127160 20:56760910-56760932 CATCAGCTGCCGAAGGAGGAAGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1179097211 21:38326540-38326562 CCTTATCTGCAAGAGTAGAATGG + Intergenic
1179396938 21:41049061-41049083 CCTCTTCTGCTGAATGAGATGGG + Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180106595 21:45622858-45622880 CCTCATCTGCAGGAGGACACTGG - Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184379667 22:44137426-44137448 CCTATTCAGCAGTAGGAGAAGGG + Intronic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949435028 3:4019862-4019884 CCTCATTTGCTGAAAGGGAAAGG + Intronic
949869102 3:8571646-8571668 CCTGGTCTGCAGCTGGAGAAAGG + Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
950150021 3:10679642-10679664 CTTTATCTCCAGCAGGAGAATGG + Intronic
953921164 3:46952810-46952832 TCTCATCTGTGGTAGGAGAAAGG - Intronic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
955116341 3:56008330-56008352 CCTGATGTGAAGAATGAGAATGG - Intronic
955137912 3:56238333-56238355 CATCCTCTGAACAAGGAGAAGGG - Intronic
955409489 3:58646615-58646637 GCTCATCTGCAAAGGGAAAACGG + Intronic
955766717 3:62351947-62351969 CATCAGTTGCAGAAGGAGAGTGG - Intergenic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956499795 3:69869895-69869917 CCTCAGCTGGAGAAGGACATGGG - Intronic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
961318633 3:126057355-126057377 CCTCACCCAGAGAAGGAGAAGGG + Intronic
961998762 3:131273113-131273135 CCACACCTGCTGAAAGAGAATGG + Intronic
962892373 3:139683527-139683549 CTTCAACTGCAGAAGTTGAAAGG + Intergenic
963212313 3:142706776-142706798 CCTGATCTGGGGAAGAAGAAGGG + Intronic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
967316953 3:188158693-188158715 TCTCATCTGCAAAATGAGACTGG - Intronic
967690343 3:192466513-192466535 CCTCCTCAGCAGAAGACGAAAGG + Intronic
968054700 3:195682498-195682520 CCACATCGGCAAAAGGACAAAGG + Intergenic
968101207 3:195966774-195966796 CCACATCAGCAAAAGGACAAAGG - Intergenic
968576974 4:1371500-1371522 CCTTATCAGCAGCAGGAAAACGG - Intronic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968869714 4:3235548-3235570 ACACATCTGCACAGGGAGAAAGG - Exonic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
969891636 4:10265192-10265214 ACACATCTGCAGAAAGAGCAAGG - Intergenic
970076472 4:12227506-12227528 CCTTATTAGCAGCAGGAGAATGG - Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971215333 4:24657304-24657326 CGTAAGCTGCAGCAGGAGAAGGG - Intergenic
973169416 4:47120877-47120899 CCTCTTCTGAAGCAGAAGAAAGG + Intronic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
974476075 4:62382306-62382328 CCTTATCAGCAGCAGGAAAAAGG - Intergenic
975204167 4:71624957-71624979 CTTCATCAGCAGCAGGAAAATGG - Intergenic
975342589 4:73258615-73258637 CGACGGCTGCAGAAGGAGAAGGG - Exonic
975831926 4:78378257-78378279 ACTCATCTACAGAAAGAAAAAGG - Intronic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
977025927 4:91819968-91819990 CCTTATCAGCAGCAGGAAAATGG - Intergenic
977122135 4:93115583-93115605 CCTTATCAGCAGCATGAGAATGG - Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
978634800 4:110791554-110791576 CATCATCTGCACAATGAGCAGGG + Intergenic
979442526 4:120768338-120768360 CCTCATCTAGAAAATGAGAATGG + Intronic
980199162 4:129632733-129632755 CCTCATCAGCAGCATGAAAATGG - Intergenic
981937664 4:150252634-150252656 CCTCATCAGCAAATGGAAAATGG - Intronic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
984863609 4:184261469-184261491 CTTCCTCTGCAGAAGAGGAAAGG - Intergenic
985210266 4:187585496-187585518 ACTCATGTGCAGAATGATAAAGG + Intergenic
985501875 5:253157-253179 CCACATCAGCAAAAGGACAAAGG + Intronic
985735138 5:1575500-1575522 CCACATCAGCAAAAGGACAAAGG - Intergenic
986551291 5:8958877-8958899 CCCCATCTTCAGCAGGACAATGG + Intergenic
986561108 5:9061590-9061612 CCTGAGCTGCGGCAGGAGAAAGG + Intronic
987086612 5:14475403-14475425 TCTCTTCTGCAGAAGCAGATGGG + Intronic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987284436 5:16441570-16441592 CCCCAACTGCAGAAGGGGTAGGG + Intergenic
992671309 5:79063751-79063773 CCTTATCTGCAGAAACACAATGG - Exonic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993389966 5:87307354-87307376 CCTAATCTGAGGCAGGAGAATGG + Intronic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
995023069 5:107388138-107388160 CCTCCTCTGCTGCAGGAAAAGGG + Intronic
995050512 5:107697820-107697842 CCTTATCTGACGAAAGAGAAAGG - Intergenic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995677428 5:114678224-114678246 GCTCATCTGCATATGTAGAAGGG + Intergenic
995949201 5:117689305-117689327 CCACATCTAGAGAAGGATAAAGG - Intergenic
996164140 5:120204756-120204778 CTTCATTAGCAGCAGGAGAATGG - Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997478172 5:134161076-134161098 CATCATCTTCAGGAGGAGGAGGG + Exonic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998888007 5:146714897-146714919 TCTCAGCTTCAAAAGGAGAAGGG - Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
998923078 5:147092314-147092336 CCCCATATGCAAATGGAGAAAGG + Intergenic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
999312792 5:150562688-150562710 CCTCATCTGCCTCAGGACAAAGG - Intergenic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1001032411 5:168272405-168272427 CCACCTCTGCAGAAAGTGAAGGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001455376 5:171856023-171856045 CCTCAGCGTCAGAAGGAGCAAGG + Intergenic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003366495 6:5479908-5479930 GCTCCTCAGGAGAAGGAGAAGGG + Intronic
1003879967 6:10471060-10471082 CCTGATCAGCAGGAGAAGAAAGG - Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1005491518 6:26351830-26351852 CCTCATCATCATAAGAAGAAGGG + Intergenic
1006627306 6:35406438-35406460 CCTCAGCTGTAGATGGAGCAAGG + Intronic
1006830734 6:36966690-36966712 CCTCATCTGAGAAAGGAGATTGG - Intergenic
1007138015 6:39541703-39541725 CCTAATCTGAAGAAGGTCAAGGG + Intronic
1007217833 6:40254293-40254315 CCTGAACTGCAGCAGGAGAGAGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007821156 6:44561516-44561538 CCTGAGCTGCAGAAGGAAAGCGG - Intergenic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1009194497 6:60667805-60667827 CTTCATCTGCAGCATGAAAATGG - Intergenic
1009228893 6:61040877-61040899 CATCATATTTAGAAGGAGAAAGG - Intergenic
1009503298 6:64443869-64443891 CCTCATCAGCAGCATGAAAATGG + Intronic
1009938792 6:70265305-70265327 CATCATCAAAAGAAGGAGAAAGG + Intronic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1011743591 6:90387644-90387666 CCTCAGCTGCCGCAGAAGAAAGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012775652 6:103490875-103490897 CCTCATATGCAAAAGGGGAGAGG + Intergenic
1013195768 6:107844297-107844319 CCTCAAGTACAGAAGTAGAATGG + Intergenic
1014475794 6:121871311-121871333 CCTTATTTGCAGCATGAGAACGG - Intergenic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020035850 7:4962753-4962775 CCTCATCGGCAGGAGGGGATAGG - Intergenic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1027919759 7:84378028-84378050 CCTCTTCTGGCCAAGGAGAAAGG - Intronic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1029714832 7:102320168-102320190 CCCCATCTGGAGATGGGGAATGG - Intronic
1031272477 7:119669638-119669660 CCTTATCTACAGAAGAACAAGGG - Intergenic
1031403894 7:121360122-121360144 CCACATCTGAAGAAAAAGAAAGG + Exonic
1032488575 7:132306837-132306859 CCCTTTCTGCAGAATGAGAAAGG - Intronic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1033401220 7:141027078-141027100 CCCCACCTGCAGTAGTAGAAGGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034040577 7:147873295-147873317 CCTTATTAGCAGAATGAGAATGG - Intronic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035123577 7:156590618-156590640 CCAAATCTGCAGCAGGAGAAGGG + Intergenic
1035791497 8:2309771-2309793 ATTCATCTGAAGAAGTAGAATGG + Intergenic
1035801308 8:2411934-2411956 ATTCATCTGAAGAAGTAGAATGG - Intergenic
1035917522 8:3641290-3641312 CCTCCTGTGCAGGTGGAGAACGG + Intronic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1037272612 8:17146209-17146231 TCTCATCTGTAGCATGAGAAAGG + Intergenic
1037512532 8:19598301-19598323 CCTCATCTGCAGAAAACCAATGG + Intronic
1039292487 8:36111481-36111503 CTTGATCTGCATAAGCAGAAGGG - Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1039631654 8:39119115-39119137 CATCAACTGGAGAATGAGAATGG - Intronic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042944902 8:74144983-74145005 TCTCTTCTGGAGAATGAGAAGGG + Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1047010107 8:120663197-120663219 CCTCATCTGCAGATAGAAATGGG + Intronic
1047199079 8:122748726-122748748 CTTCATCAGCAGAATGAAAATGG - Intergenic
1048615326 8:136067764-136067786 CCTCATCAGAAGGAGGAAAAGGG + Intergenic
1049285588 8:141773378-141773400 CCACAGGTGCAGAGGGAGAAGGG + Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049640590 8:143713405-143713427 CCACATCTGAAGCAGGAGAGAGG + Intronic
1050016847 9:1242885-1242907 CCTCATCTGTTAAAGAAGAAAGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050621219 9:7453870-7453892 CCTCGTCTGCCATAGGAGAAGGG + Intergenic
1050633090 9:7581280-7581302 ACTCAACAGCAGGAGGAGAAGGG + Intergenic
1051881199 9:21841259-21841281 CACCAGCTGCAGAAGGAGTAGGG - Intronic
1052264854 9:26560377-26560399 CCTCATCTGAAGAGTCAGAAAGG - Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1055625776 9:78175992-78176014 CCACTTCTGGAAAAGGAGAACGG - Intergenic
1056346240 9:85698389-85698411 TTTCATCTACAGAAGGAAAACGG + Intronic
1056784320 9:89579204-89579226 CCTTATTAGCAGAATGAGAATGG - Intergenic
1057204865 9:93165240-93165262 CCTTATTTGCAAAAGCAGAATGG + Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1057956714 9:99415342-99415364 CTTCATTTGTAGAACGAGAAGGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058886013 9:109321323-109321345 CCTCTTCTGGAAAAGGAGAGGGG + Intergenic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062195381 9:135270632-135270654 CCTCAGCTTCAGAAGGACAGAGG - Intergenic
1062434875 9:136542509-136542531 CGGCTTCTGCAGAGGGAGAAGGG + Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186792703 X:13014429-13014451 ACTTATCTGCAGAAGGATAAGGG - Intergenic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1193431293 X:81409424-81409446 CCTCAACTGTAAAAGGAGAGTGG + Intergenic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1195068121 X:101255548-101255570 CCTCATCTGAAGTTGCAGAAAGG + Intronic
1195758198 X:108220064-108220086 CCTTATCTGTAGAAGCATAATGG - Intronic
1196722196 X:118864847-118864869 CCTCATCTGCTGGAGGGGCAAGG + Intergenic
1196748474 X:119093272-119093294 CCTCAGCAGCAGAACCAGAAAGG - Intronic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG + Intergenic
1199371371 X:147053410-147053432 TGTCATCTGCAGACGGAGACAGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199645317 X:149904134-149904156 CCTCCTCTGCACAAGATGAATGG + Intergenic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic