ID: 1152690992

View in Genome Browser
Species Human (GRCh38)
Location 17:81717585-81717607
Sequence GGGGCACTGCCAGATGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 277}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152690992_1152691010 30 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691010 17:81717638-81717660 TGGGAGCTCATGGGTCAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 210
1152690992_1152691004 4 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691004 17:81717612-81717634 GGCTCATAAGTGGGGTGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1152690992_1152691006 11 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691006 17:81717619-81717641 AAGTGGGGTGCCAGGGCTTTGGG 0: 2
1: 0
2: 1
3: 16
4: 333
1152690992_1152691009 21 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152690992_1152690996 -6 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152690996 17:81717602-81717624 TGCCCCCTGGGGCTCATAAGTGG 0: 1
1: 0
2: 1
3: 11
4: 127
1152690992_1152691003 3 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691003 17:81717611-81717633 GGGCTCATAAGTGGGGTGCCAGG 0: 1
1: 0
2: 4
3: 8
4: 106
1152690992_1152690999 -4 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152690999 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 5
4: 104
1152690992_1152691005 10 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691005 17:81717618-81717640 TAAGTGGGGTGCCAGGGCTTTGG 0: 1
1: 1
2: 0
3: 10
4: 167
1152690992_1152691007 20 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152690992_1152690997 -5 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152690997 17:81717603-81717625 GCCCCCTGGGGCTCATAAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152690992 Original CRISPR GGGGCACTGCCAGATGCCCA AGG (reversed) Intronic
900326076 1:2109307-2109329 GAGGCACTGCCGGACGCGCAGGG + Intronic
901878481 1:12180559-12180581 GGGGCAGGGCCAGGTGGCCAGGG - Intronic
902468196 1:16630845-16630867 TGGGCGCAGCCAGAGGCCCAGGG - Intergenic
903559212 1:24215449-24215471 GGGGCACAGCCAGAAGCCCCAGG + Intergenic
903957355 1:27034529-27034551 GGGACACGGCCAGGTGCCCAGGG + Intergenic
903972644 1:27129150-27129172 GAGGCAGTGCCTGCTGCCCATGG - Intronic
904808492 1:33147964-33147986 TGTTCACTGCCTGATGCCCAGGG + Intronic
905167825 1:36093404-36093426 GGGGCTCTGCCAGGTCCCCTGGG + Exonic
906640605 1:47438545-47438567 GGGGCTCTGCAGGATGGCCATGG - Exonic
906694225 1:47813336-47813358 GGGGCACCTCCAGGTGGCCAGGG + Intronic
907841344 1:58160538-58160560 GGGGAACAGCCAGATACACACGG + Intronic
908346199 1:63236220-63236242 GGGGCATTGCCATCTGTCCAGGG - Intergenic
910461006 1:87447785-87447807 GGAGCAGTGCCTGTTGCCCAAGG - Intergenic
912474062 1:109924625-109924647 GGGGATCAGCCAGAGGCCCAAGG - Intronic
912911872 1:113769312-113769334 GGGTCATTGCCTGATGCACATGG - Intronic
914318245 1:146534120-146534142 GGAGCAGTGCCTGTTGCCCATGG - Intergenic
914345989 1:146799039-146799061 GGAGGACAGCCAGAGGCCCAGGG + Intergenic
914496114 1:148199236-148199258 GGAGCAGTGCCTGTTGCCCATGG + Intergenic
915579632 1:156805708-156805730 GGGGCTCTGGCATATGCCCTGGG - Intergenic
920401425 1:205679128-205679150 CGGGCATTGCCAGTTGACCAGGG - Intronic
923537377 1:234863477-234863499 AGGGCTCTGCATGATGCCCAGGG - Intergenic
1065770978 10:29078268-29078290 GGGTCACTGCCATCTACCCAAGG + Intergenic
1065903708 10:30229886-30229908 GGGCCAGTTTCAGATGCCCAGGG + Intergenic
1066107783 10:32170701-32170723 GGGACACTCCTAAATGCCCAGGG + Intergenic
1068835530 10:61548372-61548394 GGGGCACTGAAACATGCCCCAGG + Intergenic
1069890069 10:71647019-71647041 GGGGCACCCCCAGCTGCCCATGG + Intronic
1069910283 10:71754563-71754585 GGGGCACTGTCACCTGGCCAGGG + Intronic
1073596032 10:104801100-104801122 GGGGCACAGTCAGATGGCCTGGG + Intronic
1074049108 10:109866528-109866550 GGGCCACAGCCAAACGCCCATGG + Intronic
1075072041 10:119326118-119326140 GAGGCACAGGCAGGTGCCCATGG - Intronic
1076003880 10:126932738-126932760 GGGCCACTGGCTGATGCACAGGG + Intronic
1076585746 10:131546386-131546408 GGGGCAGGGCCAGATGCCCTGGG - Intergenic
1077196420 11:1283196-1283218 GGGGCCCTGCCAGCAGCCCCGGG + Intronic
1078795414 11:14587298-14587320 GGGACACCGCCAGATTCCAAAGG - Intronic
1079224914 11:18596546-18596568 GTGGCACTACCACAAGCCCAGGG + Intergenic
1080294684 11:30713174-30713196 GTGGCATTGCCAGATCCCCTGGG + Intergenic
1081714223 11:45237191-45237213 GGGGTACAGCCAGTAGCCCAGGG - Intergenic
1081870526 11:46380906-46380928 GAGGCAATGCCACAGGCCCAGGG + Exonic
1082075535 11:47973328-47973350 GGCGCAAGGCCAGAGGCCCACGG - Intergenic
1083666144 11:64275789-64275811 TGGGCACTGCCCCTTGCCCAGGG + Intronic
1084151911 11:67291586-67291608 GGGGCACTGCAGGGTGCACAGGG - Exonic
1084783674 11:71429177-71429199 GGAGCAGTGCCAGAGGCCCAGGG + Intronic
1087362605 11:97179806-97179828 GACGGACTGCCCGATGCCCAAGG - Intergenic
1088900857 11:114115936-114115958 GGGGTATAGCCAGCTGCCCATGG - Intronic
1089494861 11:118902790-118902812 GGGGCACTGCCAGGGGCCGGGGG + Exonic
1090826939 11:130394221-130394243 AGGGCAATGCCAGTTGTCCACGG + Intergenic
1102430870 12:112881885-112881907 TGGGCCCTGGCAGATACCCAGGG + Intronic
1102830269 12:115991744-115991766 GGGGCACTGCCAGTGGTCAAGGG - Exonic
1104814793 12:131639481-131639503 GGGGCTCTGCCAGTTGGTCAAGG + Intergenic
1105052605 12:133067832-133067854 AGGCCACTGCCACATACCCAAGG - Intergenic
1107444268 13:40456599-40456621 GAAGCACTGGCAGGTGCCCAGGG + Intergenic
1113720721 13:112553782-112553804 CGGGCAATGCCAGCTCCCCATGG + Intronic
1114893816 14:26960484-26960506 TGTGCACTGGCAGATGCCCGTGG - Intergenic
1116870126 14:50062318-50062340 AGGGCATTGCCAGGTGCCCAAGG + Intergenic
1116961899 14:50975107-50975129 AAGGCAGTGCCACATGCCCAAGG + Intergenic
1117621895 14:57595781-57595803 CTGGCACTGCAAGATGCCCTGGG + Intronic
1119129683 14:72160174-72160196 TGGGCATTTCCAGTTGCCCAGGG - Intronic
1119382684 14:74239258-74239280 TGGGCTCTGCAGGATGCCCATGG - Intergenic
1121897641 14:97663379-97663401 GGGCCACCGCCAGCTTCCCAGGG + Intergenic
1202898755 14_GL000194v1_random:24159-24181 GGGGTACCCCCAGCTGCCCAAGG + Intergenic
1129107054 15:73317801-73317823 GGGACAAGGCCAGAGGCCCAGGG + Intergenic
1130109770 15:80954531-80954553 AGGGCACTGCCAGGTGCCTGTGG - Intronic
1130655563 15:85789881-85789903 AGGGAACTGCCAGAGGCTCAAGG + Intronic
1130665970 15:85870371-85870393 GGGGCACTGCCAGAGCACCGGGG - Intergenic
1131525093 15:93146362-93146384 TGGGCAGAGCCGGATGCCCAGGG - Intergenic
1131529681 15:93180675-93180697 GAGACACTGCCAGGTTCCCACGG + Intergenic
1132626559 16:894269-894291 GGCGCACTGCCAGGTGGACAGGG - Intronic
1132638789 16:967495-967517 GGGGCAGTGCCGGCCGCCCATGG - Intronic
1132694120 16:1194543-1194565 GGGGCCCTCCCAGTTGCACAGGG + Intronic
1136400120 16:30012261-30012283 GGGGCAGTGCGGGATGCCCCAGG - Intronic
1138651774 16:58464805-58464827 CGGGTCCTGCCAGAAGCCCACGG - Intronic
1139297860 16:65918748-65918770 GTGGCACTGGATGATGCCCAAGG + Intergenic
1139987992 16:70916228-70916250 GGAGGACAGCCAGAGGCCCAGGG - Intronic
1140054759 16:71516190-71516212 GGGGCTCTGCCAGCTCTCCAGGG + Intronic
1141503306 16:84459443-84459465 GGGGCACAGCCAGCAGCCCCTGG - Intronic
1141545567 16:84765798-84765820 GGCACACAGCCAGGTGCCCAGGG - Intronic
1143029139 17:3957771-3957793 CTGGCACTGCCAGAGGCCCAAGG - Intronic
1143561976 17:7701826-7701848 AGGGCACTGCCACCTGCACAGGG + Intronic
1143855319 17:9843964-9843986 AGGGAAGTGTCAGATGCCCAGGG + Intronic
1144775409 17:17782513-17782535 GGGCCACTGCCAGATGCGCCCGG - Intronic
1145366781 17:22271878-22271900 CGGTCATTGCCACATGCCCATGG - Intergenic
1146271941 17:31490302-31490324 CGGGGACTGCCAGATACCTACGG - Intronic
1147013331 17:37469703-37469725 AGGGCACTGCCAGATACCGGCGG - Intronic
1147241903 17:39096015-39096037 GTTTCAATGCCAGATGCCCATGG + Intronic
1148351159 17:46943060-46943082 GGGGCATTGGGAGTTGCCCAAGG + Intronic
1151660084 17:75514447-75514469 GAGGTACTGCCAGGTGCCCTGGG - Intronic
1152662555 17:81549522-81549544 GGGCCACTGACAGAAGCCCAGGG - Intronic
1152690992 17:81717585-81717607 GGGGCACTGCCAGATGCCCAAGG - Intronic
1152750050 17:82058500-82058522 AAGCCTCTGCCAGATGCCCACGG + Intronic
1154309155 18:13254209-13254231 AGGGCACAGCCCGAGGCCCAGGG + Intronic
1160377225 18:78422154-78422176 GTGGCACTGCAAGATGCTCCAGG - Intergenic
1160454930 18:78993383-78993405 GGTGCACTTCCAGAGGCACAAGG + Exonic
1161303184 19:3552943-3552965 GGGGCCCTTCCAGGTGCCCCAGG - Intronic
1162410398 19:10502281-10502303 GGGGAAGTGCCCGGTGCCCAAGG - Intronic
1163008059 19:14408569-14408591 GGGCCACTGCCTGAGGCTCACGG + Exonic
1164462690 19:28462533-28462555 GTGACACTGCCAGAAGGCCAGGG + Intergenic
1165510905 19:36266260-36266282 GGGGCACAGAAAGATCCCCAGGG - Intergenic
1165511410 19:36268680-36268702 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165511958 19:36271203-36271225 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165512510 19:36273704-36273726 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165513057 19:36276245-36276267 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165513613 19:36278800-36278822 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165514163 19:36281334-36281356 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165514715 19:36283871-36283893 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165515267 19:36286404-36286426 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165515817 19:36288940-36288962 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165516368 19:36291477-36291499 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165516920 19:36294003-36294025 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165517473 19:36296526-36296548 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165518025 19:36299061-36299083 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165518576 19:36301596-36301618 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165519125 19:36304128-36304150 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165519675 19:36306643-36306665 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165520224 19:36309171-36309193 GGGGCACAGGAAGATCCCCAGGG - Intergenic
1165623843 19:37269411-37269433 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165624388 19:37271951-37271973 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165624933 19:37274478-37274500 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165625469 19:37277016-37277038 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165626005 19:37279541-37279563 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165626549 19:37282068-37282090 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165627088 19:37284593-37284615 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165627631 19:37287117-37287139 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165628166 19:37289641-37289663 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165628708 19:37292167-37292189 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165629248 19:37294692-37294714 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165629791 19:37297218-37297240 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165630333 19:37299745-37299767 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165630869 19:37302283-37302305 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1165750032 19:38253820-38253842 GGGCCACAGCCTGATGCCAAGGG + Intronic
1165798079 19:38530636-38530658 GGGACACTGACAGGGGCCCAGGG + Intronic
1166045792 19:40230115-40230137 CAGGCACTGCAAGATGCCCCAGG + Intergenic
1166353524 19:42213078-42213100 GTGGCACTGCAAGATGTCCTGGG - Intronic
1167006378 19:46778766-46778788 GGGGCAGTACCAGGAGCCCATGG + Exonic
1167712282 19:51119810-51119832 GGGGCAGTGCCTGGTGCTCATGG + Intergenic
1168100951 19:54140642-54140664 GGGCAAGTGCCAGAGGCCCAGGG - Intronic
1168713703 19:58515449-58515471 AGGGAACTGCCAGAGGCCCCAGG - Intronic
925018915 2:553450-553472 GGGGGACTGGCTGGTGCCCAGGG + Intergenic
926309206 2:11662289-11662311 GGGGCACAGCCAGATGGCGAGGG - Intronic
928101378 2:28439519-28439541 GGGGCACTGACAGATGCTCCTGG - Intergenic
928163910 2:28955445-28955467 AGGGCACAACCAGATGACCAGGG - Intergenic
928849150 2:35721137-35721159 CTGGCACTGGCAGAAGCCCAGGG - Intergenic
929093689 2:38244460-38244482 GGTGCACTGCCATATGCCTCAGG - Intergenic
934567352 2:95347973-95347995 GGGGCACTTCCCCATGCCCGAGG - Intronic
934765810 2:96879432-96879454 GGGGCACTGCCTGGCGCCCTGGG - Intronic
936529934 2:113268995-113269017 GGGGTACTGCCATGTCCCCAGGG + Intronic
937186938 2:120052714-120052736 AGGGCACTGCAAGATGAACATGG - Intronic
937658271 2:124401819-124401841 GGGGCAGTGCCCCATGACCATGG - Intronic
940185320 2:150978105-150978127 GGGATACAGCCAGATGCCTAGGG + Intergenic
940912061 2:159217618-159217640 GGGGCATTGGCAGGTACCCAGGG + Exonic
944135192 2:196391392-196391414 GGGTCCCTGCCAGATGCAGATGG - Intronic
944684929 2:202109768-202109790 AGGGCACTGCCAGCAGCTCAAGG + Exonic
944738343 2:202588831-202588853 GGGTAAGAGCCAGATGCCCAGGG + Intergenic
945036459 2:205707840-205707862 GGGGCACTGCCAGCACACCAGGG + Intronic
945906782 2:215603028-215603050 GGGGCACAGCCAGCTTCCCTTGG - Intergenic
946201408 2:218072829-218072851 GGGCCTCAGCCAGCTGCCCACGG - Exonic
947770915 2:232669335-232669357 GAGACACAGCAAGATGCCCACGG - Intronic
948057259 2:235018017-235018039 GGGGCCCTGGCAGATCTCCATGG + Intronic
948456767 2:238108107-238108129 GTGGCACTGTCACTTGCCCAAGG + Intronic
948819238 2:240530184-240530206 CGGCCACTGCCAGGTGCCCAGGG + Intronic
1168961871 20:1875604-1875626 AGGGGACGGCCAGATGGCCAGGG - Intergenic
1171123157 20:22582696-22582718 GGGGCTCTGCTGGATGGCCATGG + Exonic
1171204451 20:23267963-23267985 AGATCACTGCCAGTTGCCCATGG + Intergenic
1171467015 20:25336859-25336881 GGGGGCCAGGCAGATGCCCAGGG + Intronic
1172562338 20:35900388-35900410 GGAACACTGCCAGATGTCCTAGG - Intronic
1174980959 20:55394153-55394175 AGAGCACTGCCAAATGGCCATGG - Intergenic
1175277248 20:57780649-57780671 GGAGCACAGCCAGCTGCACAGGG + Intergenic
1175401181 20:58700945-58700967 GGGGAACTCCCAGAGGCCCCTGG - Intronic
1176368049 21:6045490-6045512 GGGGCAGTGCCATCTCCCCAAGG - Intergenic
1178188774 21:30256284-30256306 CGGGAACTCCCAGTTGCCCACGG - Intergenic
1179725993 21:43341536-43341558 GGGGCAGTGGCAGCTGCCCGGGG - Intergenic
1179755470 21:43493052-43493074 GGGGCAGTGCCATCTCCCCAAGG + Intergenic
1180064946 21:45407644-45407666 GGGGCAGTTGCTGATGCCCATGG + Intronic
1180075197 21:45458457-45458479 GTGGCAGTGCCAGCTGCCCTGGG - Intronic
1181005100 22:20009544-20009566 GGGGGACAGGCAGATGGCCAGGG + Intronic
1181419553 22:22788557-22788579 AGGGCACTGACAGGAGCCCAGGG + Intronic
1181541156 22:23573993-23574015 GGGGCACAGCCTGGTGCCCCAGG - Intronic
1181670109 22:24421969-24421991 GGGAGGCTGCCAGATGCTCAAGG + Intronic
1182106896 22:27696033-27696055 GGGAAAAGGCCAGATGCCCATGG - Intergenic
1182153413 22:28047449-28047471 GGTGCACAGCCAGACGCCAAGGG + Intronic
1183060318 22:35332791-35332813 GGAGCACTGCTAGTTACCCAGGG + Intronic
1183406618 22:37633360-37633382 AGGGTAATGCCAGAGGCCCATGG + Exonic
1183707759 22:39485093-39485115 GGGACAGTGCCAGATGCCAAAGG + Intronic
1184057250 22:42060794-42060816 GGGCCTCTGGCAGGTGCCCATGG - Intronic
1184231110 22:43158968-43158990 GGGTCAGTGCCAGAGACCCAAGG + Intronic
1184271534 22:43387282-43387304 GGAGCCCTCCCAGCTGCCCATGG + Intergenic
1184419306 22:44370320-44370342 GAGGCAGTGACAGATGCTCAGGG + Intergenic
1184537130 22:45094750-45094772 GTGGCATTGCCAGAAGCTCATGG - Intergenic
1184700900 22:46171891-46171913 CGGGCCCTGCAAGCTGCCCAAGG - Intronic
950687528 3:14629128-14629150 CGGGCACTGCCAGATGGATAGGG + Intergenic
951972434 3:28462237-28462259 AGGGTACTGCCACATGCCCAGGG - Intronic
952499981 3:33952055-33952077 GACAGACTGCCAGATGCCCAGGG + Intergenic
952828321 3:37542462-37542484 GGAGAAGGGCCAGATGCCCAGGG + Exonic
953353058 3:42230368-42230390 GGTGCCATGCCAGATCCCCAAGG + Intergenic
953391932 3:42538999-42539021 GCGGGAATGCAAGATGCCCAGGG - Intergenic
953463456 3:43099727-43099749 AGGTCCCTGCCAGATACCCAGGG + Intronic
954214886 3:49119113-49119135 GGGCCAGTGCCACAGGCCCAAGG - Exonic
954283631 3:49602294-49602316 GAGGCACTGCCAGTTGCCCTGGG - Intronic
954390280 3:50264947-50264969 GGGCCACAGCCAAAGGCCCAGGG + Intergenic
954472213 3:50707746-50707768 TGGGCATTGCCATATGCCCCTGG + Intronic
955656191 3:61247338-61247360 GAAGCACTGCCACATCCCCACGG + Intronic
955971800 3:64444720-64444742 GGGGCACTGCCAGTGCCCCAGGG + Intronic
959338998 3:105103835-105103857 GGGGCACTGCAAAGTCCCCAAGG + Intergenic
961508636 3:127387974-127387996 GGGACACTCCCAGGTCCCCAGGG - Intergenic
963779678 3:149474888-149474910 GGGGCTGTGCCAGATGCCTGGGG + Exonic
966209474 3:177438151-177438173 TGGGCTATGCCAGATGCCAAGGG + Intergenic
967437227 3:189461762-189461784 GTGGCACTGCCAGAAGCCTGGGG - Intergenic
968759756 4:2436722-2436744 GAGGCACTGCCAGCTGCCTTGGG + Intronic
969171616 4:5368573-5368595 GAGGCACTGCAATGTGCCCAAGG + Intronic
969501897 4:7558569-7558591 GCAGCACTGTCAGATGCTCAAGG - Intronic
969598810 4:8163666-8163688 GCGGCACTCCCAGCAGCCCAGGG - Intergenic
969699871 4:8762135-8762157 GGGACACTGCCTCCTGCCCACGG - Intergenic
974609425 4:64196357-64196379 GGAGTACTTACAGATGCCCAAGG + Intergenic
976931610 4:90573121-90573143 ATGGCATTGCCAGATGCTCAGGG + Intronic
980354474 4:131724641-131724663 GGGGCACGGAAAGATCCCCAAGG - Intergenic
980355554 4:131729634-131729656 GGGGCACAGAAAGATCCCCAGGG - Intergenic
980356097 4:131732125-131732147 GGGGCACGGAAAGATCCCCAGGG - Intergenic
980356631 4:131734613-131734635 GGGGCACGGAAAGATCCCCAGGG - Intergenic
980358248 4:131742082-131742104 GGGGCACGGAAAGATCCCCAGGG - Intergenic
980359865 4:131749517-131749539 GGGGCACGGAAAGATCCCCAGGG - Intergenic
980360944 4:131754484-131754506 GGGGCACGGAAAGATCCCCAGGG - Intergenic
980362027 4:131759439-131759461 GGGGCACGGAAAGATCCCCAGGG - Intergenic
980363113 4:131764401-131764423 GGGGCACGGAAAGATCCCCAAGG - Intergenic
980378168 4:131976587-131976609 GGGGCACAGAAAGATCCCCAGGG + Intergenic
985172997 4:187172432-187172454 GAGACAGTGCCAGATTCCCAGGG + Intergenic
986017105 5:3767012-3767034 GGGCCACTCACAGATGACCAGGG - Intergenic
986036468 5:3945099-3945121 AGAGCAATTCCAGATGCCCAGGG - Intergenic
986345753 5:6833733-6833755 GGGCCACTGCCAGAGTCCCCTGG - Intergenic
986705816 5:10453986-10454008 GGGGCACTGTGAGCTGCCCCAGG + Intronic
987940710 5:24532011-24532033 GGGACATTGCCAAATGTCCAGGG + Intronic
988550190 5:32193827-32193849 GGCTCTCTGCCAGCTGCCCATGG + Intergenic
998136085 5:139675451-139675473 GGGGCACTTGGAGATGCCCAGGG - Intronic
999080856 5:148842338-148842360 GAGCCACTGCCAGAGGCTCAGGG - Intergenic
1001210361 5:169805508-169805530 GGGCCACTGGCATATTCCCAAGG - Intronic
1001706244 5:173743186-173743208 TGGGCACTGCCATATTCCAAGGG - Intergenic
1001934737 5:175695993-175696015 CAGGCACTGCTAAATGCCCAGGG + Intergenic
1002256340 5:177961040-177961062 TGGCCACCGCCAGATCCCCAGGG - Intergenic
1002522070 5:179797566-179797588 GGGGCAGAGGGAGATGCCCAGGG + Intergenic
1002535636 5:179874044-179874066 GGGACTCTGCCACTTGCCCATGG - Intronic
1003369876 6:5513822-5513844 AGGGCCCTGCCAGGTTCCCAGGG + Intronic
1003516873 6:6825226-6825248 ACGGCCCTGCCAGATGCCCTGGG + Intergenic
1006887580 6:37395423-37395445 GCGGCACTGGGAGAGGCCCAGGG - Intergenic
1007119153 6:39366035-39366057 GGGAACCTGCAAGATGCCCAAGG - Intronic
1007835850 6:44673054-44673076 GGGGATCAGCCACATGCCCATGG - Intergenic
1010196642 6:73246526-73246548 AGGGCACTGACAAATCCCCAGGG + Intronic
1011610537 6:89146378-89146400 GCCGCACTACCAGCTGCCCACGG + Exonic
1015881877 6:137878543-137878565 GGGGCACGCCCAGAATCCCATGG + Exonic
1015882051 6:137879504-137879526 GTGGCCCTGCCAGCCGCCCATGG + Intronic
1016750305 6:147624333-147624355 GGGGCACTGCCACATCCCCTGGG - Intronic
1019537543 7:1537172-1537194 GGGGCTCGGCCAGATGCCAGGGG - Intronic
1020040261 7:4996268-4996290 GGGGCCCTGGAAGACGCCCAGGG + Intronic
1021602960 7:22382415-22382437 GGGGAAGTGCCAAATACCCATGG + Intergenic
1021636360 7:22698073-22698095 GGGACACTCCCAGCTGCCCCAGG + Intergenic
1022480558 7:30740647-30740669 GGGGCAATGCCAGGTGGCAATGG - Intronic
1023714053 7:43025108-43025130 GAGGCACTGCCACATGGCCATGG - Intergenic
1023830623 7:44037005-44037027 GGGGCACTCCCAGAAGGCCTCGG + Intergenic
1028002178 7:85513142-85513164 GGAGTACTTCCAGAAGCCCAAGG - Intergenic
1029456503 7:100674814-100674836 GCGGCACCGCCGGAGGCCCAGGG - Intronic
1029740952 7:102491319-102491341 GGGGCACTCCCAGAAGGCCTCGG + Intronic
1029758946 7:102590492-102590514 GGGGCACTCCCAGAAGGCCTCGG + Intronic
1030621556 7:111796086-111796108 GGGGACCTCCCAGATGCCCCAGG - Intronic
1032121028 7:129156748-129156770 GGGGCACTACAAGATGCTCTAGG + Intronic
1034418112 7:150975765-150975787 GGGTCACAGGCAGAAGCCCAAGG + Intronic
1034435314 7:151060333-151060355 GCGGCACTGCCTGAAACCCAGGG + Intronic
1034870253 7:154677283-154677305 GGATCACTGGCAGATGCTCATGG - Intronic
1037776665 8:21840223-21840245 GGGGCAGTGCCAGGGGCCCTAGG - Intergenic
1037941413 8:22953884-22953906 AGAGCACTGCCAGATGTACAAGG + Intronic
1038866028 8:31439685-31439707 GGAGCACTGCCTGATGCCAAGGG + Intergenic
1042989380 8:74621566-74621588 GGGGAAATGCCAGATGCTTATGG + Intronic
1044731147 8:95229534-95229556 GGGGAACTGCAAGGTGCCCTGGG - Intergenic
1046561020 8:115837487-115837509 GAGGCACTCACAAATGCCCATGG + Intergenic
1048218159 8:132515712-132515734 GGGGCAGTGTCAGGAGCCCATGG + Intergenic
1049576352 8:143391692-143391714 GGGGAGCTGCCAGATGCACGTGG - Intergenic
1049591856 8:143466313-143466335 GGGACACTGCCTGTGGCCCACGG - Intronic
1051522464 9:18004483-18004505 GGGGACCTGCCACATGCCAAGGG + Intergenic
1051771396 9:20583540-20583562 ATGGAAATGCCAGATGCCCAGGG - Intronic
1053527086 9:38841220-38841242 GGGGCAATGGCAGAAGCACAAGG + Intergenic
1053643188 9:40107019-40107041 GGGGCACAGAAAGATCCCCAGGG + Intergenic
1053762962 9:41358471-41358493 GGGGCACAGAAAGATCCCCAGGG - Intergenic
1054199309 9:62065651-62065673 GGGGCAATGGCAGAAGCACAAGG + Intergenic
1054541567 9:66269584-66269606 GGGGCACAGAAAGATCCCCAGGG - Intergenic
1054639044 9:67522706-67522728 GGGGCAATGGCAGAAGCACAAGG - Intergenic
1056687529 9:88778689-88778711 GGGTCACTGCCAATTGCTCAGGG + Intergenic
1056832013 9:89924816-89924838 GGGGCCCTGCCATGAGCCCAGGG - Intergenic
1056959922 9:91114105-91114127 GGGGCCATGCAATATGCCCAAGG + Intergenic
1057006936 9:91568900-91568922 GGGGAGCTGCCAGCTGCCCAAGG - Intronic
1057023577 9:91719075-91719097 TGGGTACTTGCAGATGCCCAAGG + Intronic
1059755556 9:117290189-117290211 ACGGCTCTGCCAGATACCCAAGG - Intronic
1060279960 9:122209179-122209201 GAGGCCCTGCCAGTTGACCAAGG + Intronic
1061545601 9:131302438-131302460 TGGGGACTGCCAGGTCCCCAGGG - Intronic
1061783284 9:133008175-133008197 GGGGCACTGCCAGTGGCCAGGGG + Intergenic
1061786379 9:133030989-133031011 CGGGCCCTGCCAGACGCACAGGG + Exonic
1062038542 9:134393496-134393518 GCAGGGCTGCCAGATGCCCATGG - Intronic
1062064941 9:134521698-134521720 GGGGCAGTGCCAGGAGTCCAGGG + Intergenic
1187727098 X:22214641-22214663 TGGGCACTGCCAGGTACCCCTGG - Intronic
1188616131 X:32161352-32161374 GGGAATCTGCCAGATGTCCAGGG - Intronic
1188835335 X:34948036-34948058 GGGGCCCTGCAAGATGCCAGAGG - Intergenic
1190627577 X:52351727-52351749 GGGTCACTTGCAGTTGCCCATGG + Intergenic
1195881935 X:109601556-109601578 GGGGCAGTTCGAGATGCCCAAGG + Intergenic
1199717606 X:150517481-150517503 GGGAAAATGCCAGATCCCCAGGG + Intergenic
1201898289 Y:19017751-19017773 TGGGCACTGCCATGTGGCCATGG + Intergenic