ID: 1152690998

View in Genome Browser
Species Human (GRCh38)
Location 17:81717604-81717626
Sequence CCCCACTTATGAGCCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152690998_1152691010 11 Left 1152690998 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1152691010 17:81717638-81717660 TGGGAGCTCATGGGTCAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 210
1152690998_1152691009 2 Left 1152690998 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152690998_1152691007 1 Left 1152690998 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152690998_1152691005 -9 Left 1152690998 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1152691005 17:81717618-81717640 TAAGTGGGGTGCCAGGGCTTTGG 0: 1
1: 1
2: 0
3: 10
4: 167
1152690998_1152691006 -8 Left 1152690998 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1152691006 17:81717619-81717641 AAGTGGGGTGCCAGGGCTTTGGG 0: 2
1: 0
2: 1
3: 16
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152690998 Original CRISPR CCCCACTTATGAGCCCCAGG GGG (reversed) Intronic
903775668 1:25791934-25791956 CCCCACCTATGATCACCATGTGG + Intergenic
904928712 1:34069120-34069142 CCACATTTATGAGGCCCTGGGGG - Intronic
907399613 1:54216770-54216792 CCTCACTTAAGTGCCTCAGGTGG + Intronic
915584359 1:156836220-156836242 CCCCACTTGTGAACAACAGGGGG - Intronic
915920661 1:159973228-159973250 CCCCACTCCTGAGCCCTAAGAGG - Intergenic
920848577 1:209613173-209613195 CCCCTCATAGGAGGCCCAGGAGG + Exonic
922884964 1:229012325-229012347 CCCCAGTCAGCAGCCCCAGGAGG - Intergenic
923259791 1:232257907-232257929 TCCCACTTATCAGGCCCAGCTGG + Intergenic
924228663 1:241944715-241944737 GTACATTTATGAGCCCCAGGAGG + Intergenic
1063473251 10:6306144-6306166 AGCCACTCATGAGGCCCAGGCGG - Intergenic
1064369832 10:14741556-14741578 CCCCAGATCTGAGCCCCAAGGGG + Intronic
1069557367 10:69407023-69407045 CCCCACTGCCCAGCCCCAGGTGG - Intronic
1075658952 10:124180172-124180194 CCCCACCTCTGTGCCCCAGAAGG + Intergenic
1076438328 10:130461788-130461810 GCCCACATCTGAGCCCCAGGAGG - Intergenic
1076982738 11:213476-213498 CCTGTCTTGTGAGCCCCAGGAGG + Intronic
1078920650 11:15827099-15827121 CTCCACTTAGGACTCCCAGGTGG - Intergenic
1078961255 11:16275192-16275214 CACCTCTTAGGAGCCCGAGGCGG + Intronic
1083595755 11:63917595-63917617 CCCCCCTTATGCGCCCTTGGGGG + Intergenic
1084519609 11:69655423-69655445 CCCCACTGTTGAGCCCTGGGAGG - Intronic
1092023677 12:5223162-5223184 CCCCTCTTTTGTTCCCCAGGTGG + Intergenic
1100360238 12:93870830-93870852 CCCCACATATCTGCCTCAGGGGG + Intronic
1101829516 12:108246459-108246481 CCTCAATTCTGAGCCCCAGCTGG - Intronic
1101847362 12:108373287-108373309 TTCCACTCCTGAGCCCCAGGAGG + Intergenic
1102221050 12:111194671-111194693 CCTCACCTGTAAGCCCCAGGAGG + Intronic
1105280487 13:18960070-18960092 ACCAACTTGTGAGCCCCTGGTGG + Intergenic
1118979652 14:70706206-70706228 GCCCTCCTGTGAGCCCCAGGAGG + Intergenic
1122112737 14:99513515-99513537 CCCCCCATCTTAGCCCCAGGGGG - Exonic
1124022475 15:25937346-25937368 CACCTCTGATGAGCCCCTGGTGG + Intergenic
1127354250 15:58182806-58182828 GACCACTTAGGTGCCCCAGGTGG + Intronic
1129896104 15:79107059-79107081 ACCCACTTAGGTGCCCCTGGGGG - Intergenic
1131184563 15:90263796-90263818 CCCCTCTTAGGAGCACCAGTAGG - Exonic
1134203142 16:12215502-12215524 CCCAGTCTATGAGCCCCAGGTGG - Intronic
1135150238 16:19999107-19999129 CCCATCTTATGGGCCCCAGGTGG + Intergenic
1136024884 16:27462941-27462963 CCCCACTCGTGGGCCCCGGGTGG - Intronic
1136508419 16:30721199-30721221 TCCCACTCAGGACCCCCAGGGGG - Exonic
1140442722 16:74999602-74999624 CCCCACTTCTCAGCAGCAGGGGG - Exonic
1140479889 16:75256830-75256852 CCCCACCTGCCAGCCCCAGGAGG - Intronic
1145039870 17:19569709-19569731 CCCAACCTATGAGCCCAAAGTGG - Intronic
1147606614 17:41777296-41777318 CCCCACATAGCAGTCCCAGGGGG + Intronic
1149382848 17:56111025-56111047 GGCCGCTTCTGAGCCCCAGGTGG + Intronic
1151540128 17:74760535-74760557 CCCAACTTGCCAGCCCCAGGAGG - Intronic
1151983292 17:77526760-77526782 CTCCAGCTCTGAGCCCCAGGGGG - Intergenic
1152652190 17:81499830-81499852 CCCCACTGCTGAGCCACAGCTGG + Intergenic
1152690998 17:81717604-81717626 CCCCACTTATGAGCCCCAGGGGG - Intronic
1161164773 19:2780483-2780505 CCCCACAGATGACCCCCAGCTGG - Intronic
1161467101 19:4437109-4437131 CTGCACTGCTGAGCCCCAGGAGG - Intronic
1162362405 19:10227886-10227908 TCTCACTTATGAACCCCAGGAGG - Intronic
1165064905 19:33223460-33223482 CCCCACCTTTCTGCCCCAGGTGG - Intronic
1166943334 19:46382061-46382083 CCCCACTTCTGTACCTCAGGAGG + Intronic
1168185014 19:54695021-54695043 CCCCACTAATGAGCCCTGGGTGG + Intronic
927436787 2:23073499-23073521 CCCTACTTAGGAGCCACAGAGGG + Intergenic
928148842 2:28808080-28808102 CTCCCATTATGATCCCCAGGAGG - Intronic
930896425 2:56451957-56451979 ACCCTCTTCTGGGCCCCAGGAGG + Intergenic
933897010 2:86821056-86821078 CCCCACTTCTGAACCACAGGCGG + Intronic
934561992 2:95318170-95318192 CCCCACTCATGGGCCCAGGGAGG + Intronic
941885538 2:170523692-170523714 CCCCACTTATGGCCACGAGGTGG + Intronic
942342164 2:174960062-174960084 CTCCAAGTTTGAGCCCCAGGAGG - Intronic
946050653 2:216859656-216859678 TCCCACTTGTGAGCCCCCAGCGG - Exonic
947499975 2:230664668-230664690 CCCCACTTCTGATCCTGAGGTGG - Intergenic
948423916 2:237876300-237876322 CCTCACTCATGAGGCCCAGGGGG + Intronic
948846849 2:240687448-240687470 CCCAGCTGATGGGCCCCAGGTGG + Intergenic
949040158 2:241844251-241844273 CCCCACCCACGCGCCCCAGGCGG - Intergenic
1170388943 20:15851267-15851289 CCCCACTCCTGAGCCCCTGTTGG - Intronic
1173055360 20:39606928-39606950 CCCCACTTATGACTCCCTGCTGG + Intergenic
1173190089 20:40869573-40869595 CCCCACTAATGAGCTGGAGGTGG - Intergenic
1173622521 20:44447767-44447789 ATCCACTCATGAGCCACAGGAGG - Intergenic
1176381814 21:6117557-6117579 CCCCACACCTGAGCACCAGGTGG - Intronic
1176715973 21:10349118-10349140 CCCCACTTAAGAGGGACAGGTGG + Intergenic
1179270450 21:39846662-39846684 CTCCAGTTCTGAGCCCCAGCAGG - Intergenic
1179741658 21:43420682-43420704 CCCCACACCTGAGCACCAGGTGG + Intronic
1182041494 22:27242005-27242027 CCCAGCTAATGAGCCCCAGAGGG - Intergenic
1183769689 22:39913241-39913263 CACCAGGTATGAGCCCCAGGAGG + Intronic
1184038522 22:41929785-41929807 CCCCATTTAGGAGGCCCAAGTGG - Intergenic
1185083732 22:48724644-48724666 CCACTCCTTTGAGCCCCAGGGGG - Intronic
950447071 3:13044567-13044589 CCCCAGTTATCAGCCCAAGTTGG - Intronic
950733612 3:14985846-14985868 TCCCACATATGAGCCCAAGGAGG - Intronic
952363158 3:32651231-32651253 AGCCACTGGTGAGCCCCAGGAGG + Intergenic
953392792 3:42543568-42543590 CTCCTCTTCTCAGCCCCAGGAGG - Intergenic
954196515 3:49000300-49000322 CAGCACTTTTGAGCCCGAGGTGG + Intronic
956175407 3:66468600-66468622 CCCAACTTCTGAGCACCAGTGGG + Intronic
959942415 3:112093144-112093166 CCCCACTTCAGAGCCCCCAGAGG + Intronic
962020400 3:131494107-131494129 CTCCACTGGAGAGCCCCAGGGGG - Intronic
962273756 3:133997012-133997034 ACCCTCTTATGATCCACAGGAGG - Intronic
962720719 3:138172333-138172355 CACCACTTTGGAGGCCCAGGTGG + Intronic
970322009 4:14884127-14884149 GCCCATTTATGAGCCCCAGGTGG - Intergenic
972724329 4:41732897-41732919 CCCAACTTTTGGGGCCCAGGAGG + Intergenic
980291661 4:130852829-130852851 CCCCACTTCTGAGACCCTGCAGG - Intergenic
985665422 5:1179522-1179544 CCCCACTCCTGAGCCCCTGCAGG - Intergenic
990897841 5:60717911-60717933 CCCAACTTGGGAGCCCCAGGTGG + Intergenic
991460798 5:66856045-66856067 TCCCACTTAGGAGGCTCAGGTGG + Intronic
998135620 5:139672911-139672933 CCCCACACAGGAGCCCCAGAAGG + Intronic
1002076389 5:176711041-176711063 CCCCTCTAATGAGCCAAAGGAGG + Intergenic
1006795665 6:36730816-36730838 CCCCACTCTTGACTCCCAGGTGG + Intronic
1007301960 6:40874448-40874470 CCCCACTTATGAGCCATGTGAGG - Intergenic
1018279636 6:162171827-162171849 CCTCATATATGAGCCCTAGGAGG + Intronic
1018540049 6:164869705-164869727 CCCCCCTCATGAGCCCATGGTGG + Intergenic
1019552549 7:1610396-1610418 GCCCACTCGTGAGCCCCCGGGGG + Intergenic
1020007369 7:4789813-4789835 TCCCACTCCTGACCCCCAGGTGG + Exonic
1022505798 7:30908118-30908140 CCCCACTTCTGAACCCTGGGCGG - Intergenic
1023743112 7:43298492-43298514 CCTCAATTATGATCCCCAGTCGG - Intronic
1025139066 7:56447915-56447937 CTCCACTGAAGATCCCCAGGAGG + Intergenic
1026889342 7:73973120-73973142 CCCCACTCATGTGCCCCTGTGGG + Intergenic
1033598244 7:142871360-142871382 CCCCACTTATGACCCTGGGGTGG + Exonic
1035320278 7:158024636-158024658 CCCCACAGATCAGCCCCATGGGG - Intronic
1037801405 8:22037760-22037782 CCCCAGGTATGGGGCCCAGGAGG + Intergenic
1037832749 8:22198894-22198916 CACCTCTTAGGAGTCCCAGGTGG - Intronic
1039414096 8:37378974-37378996 CCCCACTGCTGAGCTCAAGGAGG + Intergenic
1040549186 8:48425328-48425350 GCCCACTGCTGAGTCCCAGGTGG - Intergenic
1040824497 8:51606883-51606905 CCACATGTATGAGCCACAGGTGG - Intronic
1045545681 8:103126131-103126153 CCCCACATATGAGACCCGGTGGG - Intergenic
1048955054 8:139529113-139529135 GCCCACTTAGGAAGCCCAGGTGG - Intergenic
1049657030 8:143803557-143803579 CCCCACAGGTGAGCCCCACGGGG - Exonic
1057025607 9:91732320-91732342 CCCAAGTTGTGAGCCCCAGCAGG - Intronic
1059512216 9:114859398-114859420 CACTACATATGAACCCCAGGAGG - Intergenic
1061628190 9:131854676-131854698 CTCCACTTAAGAGCCCCACCAGG - Intergenic
1061916161 9:133755581-133755603 CCCCTCTTATCAGCCCCAAGAGG - Intergenic
1062431191 9:136527552-136527574 CCTCACTTTTTAGCCCCAGAGGG - Intronic