ID: 1152691000

View in Genome Browser
Species Human (GRCh38)
Location 17:81717605-81717627
Sequence ACCCCACTTATGAGCCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152691000_1152691005 -10 Left 1152691000 17:81717605-81717627 CCCCTGGGGCTCATAAGTGGGGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1152691005 17:81717618-81717640 TAAGTGGGGTGCCAGGGCTTTGG 0: 1
1: 1
2: 0
3: 10
4: 167
1152691000_1152691009 1 Left 1152691000 17:81717605-81717627 CCCCTGGGGCTCATAAGTGGGGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152691000_1152691010 10 Left 1152691000 17:81717605-81717627 CCCCTGGGGCTCATAAGTGGGGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1152691010 17:81717638-81717660 TGGGAGCTCATGGGTCAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 210
1152691000_1152691006 -9 Left 1152691000 17:81717605-81717627 CCCCTGGGGCTCATAAGTGGGGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1152691006 17:81717619-81717641 AAGTGGGGTGCCAGGGCTTTGGG 0: 2
1: 0
2: 1
3: 16
4: 333
1152691000_1152691007 0 Left 1152691000 17:81717605-81717627 CCCCTGGGGCTCATAAGTGGGGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152691000 Original CRISPR ACCCCACTTATGAGCCCCAG GGG (reversed) Intronic
905404380 1:37723207-37723229 AGCCCGCTTGTCAGCCCCAGTGG - Intronic
908829486 1:68164984-68165006 TCCCCACTTAGTAGCCTCAGTGG + Intronic
920938284 1:210456439-210456461 ACCCCCTTTTTGAGCACCAGAGG + Intronic
921522728 1:216176584-216176606 ACACCACGTGTGAGCCCCAATGG - Intronic
1064222115 10:13450457-13450479 GCCCCACTTCTGTGCCCTAGAGG + Intronic
1064369830 10:14741555-14741577 ACCCCAGATCTGAGCCCCAAGGG + Intronic
1069574476 10:69516972-69516994 ATCCCATGTGTGAGCCCCAGAGG + Intergenic
1069717495 10:70530310-70530332 ACCCTACTTGGGAGCCTCAGAGG + Intronic
1074887860 10:117708597-117708619 ACCCACCACATGAGCCCCAGTGG - Intergenic
1078012044 11:7579992-7580014 ACCCCAGTGATGAGCCCCCCTGG + Intronic
1079320867 11:19450195-19450217 ACCCCTCTTCTGAGCACCTGGGG + Intronic
1080778029 11:35404350-35404372 ACCCCGCTGATGACTCCCAGGGG + Intronic
1081711556 11:45219784-45219806 CGCCCACCTCTGAGCCCCAGGGG + Intronic
1083595753 11:63917594-63917616 ACCCCCCTTATGCGCCCTTGGGG + Intergenic
1083759968 11:64810373-64810395 ACCCCAATGAGGAGCCCCAATGG + Intronic
1085041877 11:73331455-73331477 CCCCCACTCCTGGGCCCCAGTGG + Intronic
1089765063 11:120757228-120757250 ACCTCACTTATGCTGCCCAGTGG - Intronic
1090233703 11:125129774-125129796 ACCCTACTTCAGAACCCCAGAGG + Intergenic
1092743866 12:11654980-11655002 ACCCCAGATGTGAGCACCAGAGG + Intronic
1094842118 12:34346543-34346565 ACCCCACGTATGCGCTACAGAGG + Intergenic
1096162077 12:49387156-49387178 ACACCACTTTAGGGCCCCAGAGG + Intronic
1096492106 12:52018657-52018679 TCCCCACCTCTGAGCCCCAGGGG + Intergenic
1099011376 12:77295253-77295275 TCCCCACTTCTTACCCCCAGAGG - Intergenic
1100360236 12:93870829-93870851 ACCCCACATATCTGCCTCAGGGG + Intronic
1109752178 13:66708761-66708783 ACTCCACTTTTGAGCTACAGGGG - Intronic
1111105122 13:83635371-83635393 ACCCCAGTTAAGAGCCCAAATGG + Intergenic
1116902767 14:50377621-50377643 ACCCCACTTATCATCAGCAGTGG - Intronic
1122922572 14:104886059-104886081 CACCCACTTCTGACCCCCAGGGG - Exonic
1123951966 15:25287935-25287957 AACCCACCTATAAGCCACAGGGG + Intergenic
1128340486 15:66819278-66819300 GTACCACTTGTGAGCCCCAGGGG - Intergenic
1133564310 16:6978748-6978770 ACCCCAGATTTGAACCCCAGTGG + Intronic
1141914099 16:87082188-87082210 GCCCCACCTCTGAGACCCAGGGG - Intergenic
1150248624 17:63693922-63693944 ACCCCGGCTCTGAGCCCCAGTGG - Exonic
1150266137 17:63833540-63833562 ACCCCAATCCTGGGCCCCAGAGG + Intronic
1151348358 17:73516927-73516949 ACCCCACTTATGATTCCCTGGGG - Intronic
1152688763 17:81707992-81708014 ACCCCACTTAAGGGCCCCAGAGG - Intergenic
1152691000 17:81717605-81717627 ACCCCACTTATGAGCCCCAGGGG - Intronic
1155161856 18:23202525-23202547 ACCCTACTTGTGTGCCACAGTGG + Intronic
1156173143 18:34510572-34510594 ACGCCTTTTATGAGCCCCTGTGG + Intronic
1156301003 18:35835983-35836005 ACCCCTCCTTTGGGCCCCAGAGG + Intergenic
1167851025 19:52202048-52202070 TCCCCACATCTGGGCCCCAGGGG - Intronic
927436785 2:23073498-23073520 GCCCTACTTAGGAGCCACAGAGG + Intergenic
927966871 2:27275782-27275804 ACCCCACTTCTGTCCCTCAGAGG - Intronic
929218910 2:39443367-39443389 AGCCAAATTATTAGCCCCAGGGG - Intergenic
932837793 2:75053519-75053541 GGCACACTTGTGAGCCCCAGAGG - Intronic
933785885 2:85841221-85841243 ATCCCACTTAAGGGCCCCATTGG + Intronic
935175398 2:100644374-100644396 ACCCCACTGATGTGCTGCAGAGG + Intergenic
935291146 2:101611991-101612013 ACCCCACTTCCCAGTCCCAGAGG - Intergenic
936368733 2:111884636-111884658 ACCCAAGTTAAGAACCCCAGCGG + Exonic
946013947 2:216588837-216588859 AACTCACTGATGGGCCCCAGGGG + Intergenic
947707446 2:232287921-232287943 ACCCCAGGTATGGGCCCCATAGG + Intronic
948423914 2:237876299-237876321 TCCTCACTCATGAGGCCCAGGGG + Intronic
1170921873 20:20686885-20686907 ATCTCACTCAGGAGCCCCAGTGG + Intronic
1182041496 22:27242006-27242028 GCCCAGCTAATGAGCCCCAGAGG - Intergenic
1183508773 22:38223254-38223276 GCCCCTCTGCTGAGCCCCAGTGG + Intronic
951617308 3:24562054-24562076 ACTACAGGTATGAGCCCCAGTGG - Intergenic
951627661 3:24683699-24683721 ATCACACCTATGAGTCCCAGGGG - Intergenic
952836446 3:37606517-37606539 ACCCCAACTCTGAGCCCCAGGGG + Intronic
952948059 3:38494405-38494427 ACCCCACTTTTGGTCCCAAGAGG - Intergenic
956171527 3:66437357-66437379 ACCCCAATAATGAGCCCTGGGGG + Intronic
956175405 3:66468599-66468621 ACCCAACTTCTGAGCACCAGTGG + Intronic
957844186 3:85710071-85710093 ATCCCACTTTTTAGACCCAGTGG - Intronic
963078615 3:141370844-141370866 CCCCCAACTATGAGCCCCAGTGG + Intronic
963728657 3:148949263-148949285 AACCCAGTTTTGAGACCCAGAGG + Intergenic
969049411 4:4362120-4362142 ACACCACTTATGAGCTGTAGTGG + Intronic
970338394 4:15078346-15078368 ATCCCACTTATGAGCACATGTGG + Intergenic
975134965 4:70865850-70865872 ACCTCACTTAAGAGTCTCAGAGG - Intergenic
994293910 5:98065718-98065740 ACCCTGCCTATGGGCCCCAGAGG - Intergenic
995548137 5:113253099-113253121 AGTCCATTTATGTGCCCCAGTGG - Intronic
1001670263 5:173468012-173468034 TCCCCACTTGTGATCCACAGAGG - Intergenic
1006907932 6:37545563-37545585 AGCCTTCTTAGGAGCCCCAGAGG - Intergenic
1007102737 6:39261298-39261320 ACCCCATTTAGGAAACCCAGTGG + Intergenic
1007139081 6:39553844-39553866 ATCCCACTTAAGGTCCCCAGGGG - Intronic
1011489135 6:87872606-87872628 ACCCCAAATCTGAACCCCAGAGG + Intergenic
1012675926 6:102113175-102113197 ACCCCACTTAAAAGGCACAGAGG - Intergenic
1026889340 7:73973119-73973141 GCCCCACTCATGTGCCCCTGTGG + Intergenic
1030306095 7:108020036-108020058 AGCCCACGTTTGAACCCCAGAGG - Intergenic
1037586867 8:20283014-20283036 ATCCCACTTCTGAGCCCCCAGGG - Intronic
1038423112 8:27446193-27446215 CCCCCTCTCCTGAGCCCCAGGGG + Intronic
1039782445 8:40798565-40798587 ACCCCACTTTAGAGCCACAGAGG + Intronic
1040779332 8:51088999-51089021 ACACCACTTGTAAGTCCCAGGGG - Intergenic
1042515587 8:69655322-69655344 ACTCATTTTATGAGCCCCAGTGG + Intronic
1045545683 8:103126132-103126154 TCCCCACATATGAGACCCGGTGG - Intergenic
1048913456 8:139159010-139159032 TCACCACTTATGAGCACCACAGG - Intergenic
1055837265 9:80458180-80458202 ACCCCATTAATGAGACCCAAGGG - Intergenic
1061482672 9:130904670-130904692 ACCACACTTTAGAGACCCAGCGG + Intronic
1062431193 9:136527553-136527575 GCCTCACTTTTTAGCCCCAGAGG - Intronic
1062701138 9:137904185-137904207 ACCCAAGTTGTGAGCCCCAGTGG - Intronic
1188449148 X:30290748-30290770 TCCCCTCTTTTGTGCCCCAGTGG - Intergenic
1189250324 X:39595966-39595988 TGCCCACCTATGAGCCCAAGAGG + Intergenic
1196467588 X:115988997-115989019 ACCCCCCTTTTGGGCACCAGAGG + Intergenic
1199414997 X:147572047-147572069 ACCCCACTTAAAAGGCACAGAGG + Intergenic