ID: 1152691001

View in Genome Browser
Species Human (GRCh38)
Location 17:81717606-81717628
Sequence CACCCCACTTATGAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152691001_1152691006 -10 Left 1152691001 17:81717606-81717628 CCCTGGGGCTCATAAGTGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 85
Right 1152691006 17:81717619-81717641 AAGTGGGGTGCCAGGGCTTTGGG 0: 2
1: 0
2: 1
3: 16
4: 333
1152691001_1152691007 -1 Left 1152691001 17:81717606-81717628 CCCTGGGGCTCATAAGTGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 85
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152691001_1152691009 0 Left 1152691001 17:81717606-81717628 CCCTGGGGCTCATAAGTGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 85
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152691001_1152691010 9 Left 1152691001 17:81717606-81717628 CCCTGGGGCTCATAAGTGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 85
Right 1152691010 17:81717638-81717660 TGGGAGCTCATGGGTCAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152691001 Original CRISPR CACCCCACTTATGAGCCCCA GGG (reversed) Intronic
904433331 1:30479141-30479163 CACCCGAGTGCTGAGCCCCAAGG + Intergenic
904699218 1:32348339-32348361 CACCCCACCCATGAGCTCCTTGG - Intergenic
908621270 1:65983009-65983031 CACCCCATTCATGGGCCCAAAGG + Intronic
910698870 1:90050548-90050570 CATCCCATTTTTGAGCCACAGGG - Intergenic
912856138 1:113170228-113170250 CACCCCACTTAGCATCCCCAAGG + Intergenic
912897577 1:113609158-113609180 CTCCCCACGTAATAGCCCCACGG + Intronic
915734961 1:158078713-158078735 CACCCCAGTTTTCAGCCTCAAGG - Intronic
915776363 1:158492055-158492077 CACCCCAGTCTTGAACCCCATGG + Intergenic
915880151 1:159661560-159661582 CAACCCAATAATGAACCCCAAGG - Intergenic
919594111 1:199540207-199540229 CACCCCACTTAAAAGGCACAGGG + Intergenic
920527280 1:206676518-206676540 TCTCCCATTTATGAGCCCCAGGG - Intronic
1064369829 10:14741554-14741576 GACCCCAGATCTGAGCCCCAAGG + Intronic
1068593810 10:58879852-58879874 CAACCTACTTATGAACCTCATGG - Intergenic
1069421714 10:68252429-68252451 CACTCCACTCATGAGGACCAAGG - Intergenic
1069782578 10:70966041-70966063 CCCCCCAGTTATGGTCCCCAGGG - Intergenic
1075347885 10:121697629-121697651 CACCCTCCTTCAGAGCCCCATGG + Intergenic
1076112902 10:127874286-127874308 CACCCCGCTTGTGAGTCTCATGG - Intergenic
1076379270 10:130014121-130014143 CGCCCCGCCTCTGAGCCCCAGGG - Intergenic
1077188081 11:1244356-1244378 CACCCCACATGTGAGCACCACGG + Exonic
1077189036 11:1248127-1248149 CACCCCACATGTGAGCACCACGG + Exonic
1077189599 11:1250311-1250333 CACCCCACATGTGAGCACCACGG + Exonic
1080468970 11:32526566-32526588 CATCCCACTTTCCAGCCCCAGGG - Intergenic
1081807439 11:45898204-45898226 CACCCCACTCAGGAGCTCCTGGG - Intronic
1084858491 11:72003640-72003662 CCCCTCCCTTGTGAGCCCCAGGG + Intronic
1089499412 11:118923705-118923727 CACCCCACTCAGGAGCAACATGG + Intronic
1089625814 11:119750153-119750175 CACCCCACTTCTGGGTCCCAAGG - Intergenic
1095421053 12:42024002-42024024 CAGCCCACTAAAGAGCACCAAGG + Intergenic
1096011991 12:48225680-48225702 CACCCTACTTATAAGCCATATGG - Intergenic
1096492105 12:52018656-52018678 CTCCCCACCTCTGAGCCCCAGGG + Intergenic
1096520617 12:52182644-52182666 CACCCTACTTATGTTCCCCTAGG - Intronic
1103358776 12:120341814-120341836 TCCCCCAGTTATGAGGCCCAGGG - Exonic
1109752179 13:66708762-66708784 CACTCCACTTTTGAGCTACAGGG - Intronic
1112598739 13:100833780-100833802 CAGCCCACTTCTCAGCCCCCAGG - Intergenic
1115700188 14:35945916-35945938 CACCCCAGTTTTGAGACCCCTGG + Intergenic
1121520869 14:94585488-94585510 CTCTCCACTGCTGAGCCCCACGG + Intronic
1124581464 15:30959226-30959248 CACCCCACTTAGTAGCCACATGG + Intronic
1124618819 15:31262392-31262414 CACACCTCTTCTGAGTCCCAGGG - Intergenic
1130436036 15:83901003-83901025 CAGCCCAGTGGTGAGCCCCAGGG + Intronic
1130677112 15:85962745-85962767 CACCTCATTTATTAGCCACATGG - Intergenic
1130893259 15:88151017-88151039 CACCCTGCCTCTGAGCCCCACGG + Intronic
1136033805 16:27523071-27523093 CACCTCAGTCATTAGCCCCAGGG + Intronic
1139649635 16:68355868-68355890 CACCCACCTTCTGAGCTCCACGG - Exonic
1140829845 16:78740988-78741010 TATCCCACTTAGGAGACCCATGG - Intronic
1143204310 17:5131914-5131936 CATCCCACTTGACAGCCCCAAGG - Intronic
1143768466 17:9152641-9152663 CACCCCACTTCTGAATTCCAGGG + Intronic
1144286400 17:13778862-13778884 CACCCCAGATATGACCACCAAGG + Intergenic
1144653760 17:17022520-17022542 CACCCCACTGCTGACCACCAGGG - Intergenic
1144875381 17:18394604-18394626 CATCCCACTTGACAGCCCCAAGG - Intergenic
1145065172 17:19757170-19757192 CTCCCCACCTCTGTGCCCCAAGG + Intergenic
1145156844 17:20549817-20549839 CATCCCACTTGACAGCCCCAAGG + Intergenic
1145799014 17:27671691-27671713 CATCCCACTTGAGAGTCCCAAGG + Intergenic
1146844362 17:36173909-36173931 CACCCCACTTGACAGCCCCAAGG + Intronic
1146856667 17:36261844-36261866 CACCCCACTTGACAGCCCCAAGG + Intronic
1146863950 17:36326531-36326553 CACCCCACTTGACAGCCCCAAGG - Intronic
1146872577 17:36385755-36385777 CACCCCACTTGACAGCCCCAAGG + Intronic
1146879935 17:36436840-36436862 CACCCCACTTGACAGCCCCAAGG + Intronic
1147066810 17:37927119-37927141 CACCCCACTTGACAGCCCCAAGG - Intronic
1147075461 17:37986379-37986401 CACCCCACTTGACAGCCCCAAGG + Intronic
1147078342 17:38006680-38006702 CACCCCACTTGACAGCCCCAAGG - Intronic
1147086986 17:38065925-38065947 CACCCCACTTGACAGCCCCAAGG + Intronic
1147094280 17:38130615-38130637 CACCCCACTTGACAGCCCCAAGG - Intergenic
1147102931 17:38189888-38189910 CACCCCACTTGACAGCCCCAAGG + Intergenic
1149847504 17:60016355-60016377 CATCCCACTTGACAGCCCCAAGG + Intergenic
1150085862 17:62272972-62272994 CATCCCACTTGACAGCCCCAAGG + Intronic
1151234124 17:72706127-72706149 CACCCCACATCTGAAACCCAAGG - Intronic
1151348359 17:73516928-73516950 CACCCCACTTATGATTCCCTGGG - Intronic
1152691001 17:81717606-81717628 CACCCCACTTATGAGCCCCAGGG - Intronic
1161611515 19:5245742-5245764 CCCTCCACCTACGAGCCCCATGG + Intronic
1163123269 19:15231052-15231074 CACCCCAGTCATGGGCCACAAGG + Exonic
1163129476 19:15263696-15263718 CACCCCAGTTCTCAGCCTCAGGG + Intronic
1163279904 19:16309527-16309549 CACCCCAATTATGAGGCTGAAGG + Intergenic
1165453544 19:35898626-35898648 CACCCCTCTCATCAGCCCCGAGG + Intronic
1167349013 19:48963476-48963498 CCCTCCACCTATGGGCCCCAAGG + Intergenic
926389188 2:12370107-12370129 CACCCCAATGATGCTCCCCACGG - Intergenic
928181374 2:29071150-29071172 CAGCCCACCTGTGAGCCCCAGGG - Exonic
929436600 2:41933336-41933358 CTCCCCACTTGTGGGCACCATGG + Intergenic
942962800 2:181852964-181852986 CACACTATTTATGAGACCCAGGG - Intergenic
947753045 2:232542738-232542760 CACCCCACTTCTGTCCCTCAAGG + Intronic
1169273394 20:4217375-4217397 CACCCCAAATACAAGCCCCAAGG - Intergenic
951627662 3:24683700-24683722 CATCACACCTATGAGTCCCAGGG - Intergenic
952836445 3:37606516-37606538 AACCCCAACTCTGAGCCCCAGGG + Intronic
962343914 3:134606244-134606266 CACCCCACACAGCAGCCCCAGGG + Intronic
967941679 3:194771224-194771246 CACCACCCTCATCAGCCCCATGG - Intergenic
968603083 4:1519574-1519596 CACCCCACTTCGGACCCCCTTGG + Intergenic
978390382 4:108219089-108219111 CACCCCACTTCTGGGCTCCTGGG - Intergenic
980744749 4:136999726-136999748 CAGCCCACTTGAGAGCCACATGG - Intergenic
989091945 5:37743174-37743196 CAACCCACTTGAGAGCCACACGG + Intronic
995740017 5:115346558-115346580 CTCCACACTTATGGGCTCCAAGG - Intergenic
1002932465 6:1644019-1644041 CACCTCCCCTCTGAGCCCCAGGG + Intronic
1005116734 6:22346569-22346591 CAACCCATTTATGAGCCACAAGG - Intergenic
1006139911 6:31922166-31922188 CACCCCAGTGATAAGGCCCAAGG + Intronic
1007451799 6:41945647-41945669 CACCCCTGTTCTCAGCCCCATGG - Intronic
1018319266 6:162589042-162589064 CACCCCACCTTTGGGCACCATGG + Intronic
1023983422 7:45082252-45082274 CTCCCCACTCCTCAGCCCCAAGG - Exonic
1035721052 8:1792152-1792174 CACACCACTTATGAGACACCTGG + Intergenic
1037586868 8:20283015-20283037 CATCCCACTTCTGAGCCCCCAGG - Intronic
1040904072 8:52447262-52447284 TACCCTACATATGAGGCCCAGGG + Intronic
1041293047 8:56325636-56325658 AGCCCCACTCATGGGCCCCATGG + Intergenic
1042643619 8:70961292-70961314 CACTTCACTTAAGAGGCCCATGG - Intergenic
1048277843 8:133080660-133080682 CACCCTCCTTATCAGCCCCATGG + Intronic
1048591788 8:135827119-135827141 CACCCAGCTGGTGAGCCCCAGGG - Intergenic
1049233134 8:141494550-141494572 CCCCCAACTTACGAGCCCCTTGG + Intergenic
1049247616 8:141571225-141571247 CACCCCACTGGGGAGCCCCTGGG - Intergenic
1049657033 8:143803559-143803581 CTCCCCACAGGTGAGCCCCACGG - Exonic
1051285866 9:15495132-15495154 CACCCCAATTTTGAGCCCTTTGG - Intronic
1055837266 9:80458181-80458203 GACCCCATTAATGAGACCCAAGG - Intergenic
1189906001 X:45760283-45760305 CACTCCAGTTATGAGGCACAAGG + Intergenic
1190064359 X:47229876-47229898 CACCCCATTTCAGGGCCCCAGGG - Exonic
1192799250 X:74450193-74450215 CACCCCCATTATATGCCCCAGGG + Intronic