ID: 1152691002

View in Genome Browser
Species Human (GRCh38)
Location 17:81717607-81717629
Sequence GCACCCCACTTATGAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152691002_1152691010 8 Left 1152691002 17:81717607-81717629 CCTGGGGCTCATAAGTGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1152691010 17:81717638-81717660 TGGGAGCTCATGGGTCAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 210
1152691002_1152691007 -2 Left 1152691002 17:81717607-81717629 CCTGGGGCTCATAAGTGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152691002_1152691009 -1 Left 1152691002 17:81717607-81717629 CCTGGGGCTCATAAGTGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152691002 Original CRISPR GCACCCCACTTATGAGCCCC AGG (reversed) Intronic
902940229 1:19795863-19795885 ACATCCCACTTCTGAGCCCCAGG + Intronic
904312335 1:29636952-29636974 GCACCAGACTTATGGCCCCCAGG - Intergenic
910353002 1:86321137-86321159 GGACCCCAGGTAAGAGCCCCTGG - Intergenic
911182273 1:94871651-94871673 GAAACCCACTGGTGAGCCCCAGG + Intronic
914432736 1:147633810-147633832 GCACCTCAGTTATGAGCTCCAGG - Intronic
920593624 1:207247255-207247277 GCACCCAAATTATCAGTCCCAGG + Intergenic
922616961 1:226966210-226966232 TCACTCCACTCATGAGCCGCAGG - Intronic
923181810 1:231527522-231527544 GCACCCCAGTTATGAAGCCTTGG + Intergenic
924568574 1:245218241-245218263 GCACCCCACTGAGAAGCCACAGG - Intronic
1063934825 10:11066587-11066609 GCATCCCACTTGTCAGCCTCAGG + Intronic
1069923847 10:71834447-71834469 GCACCACACTGCCGAGCCCCTGG + Exonic
1072744828 10:97932724-97932746 GCACCCCTCCTATGTGACCCGGG - Intronic
1073077198 10:100831617-100831639 GCACCCCACTTTGGAGATCCTGG + Intergenic
1075375956 10:121978384-121978406 GCACCCCACTTCTCAGCCTTTGG + Intergenic
1076438329 10:130461791-130461813 GAAGCCCACATCTGAGCCCCAGG - Intergenic
1079291235 11:19189671-19189693 GCCCCACACTCATCAGCCCCTGG - Intronic
1080418316 11:32089978-32090000 AAGCCCCACCTATGAGCCCCAGG - Intronic
1081807440 11:45898205-45898227 CCACCCCACTCAGGAGCTCCTGG - Intronic
1083595751 11:63917592-63917614 GGACCCCCCTTATGCGCCCTTGG + Intergenic
1091921134 12:4305826-4305848 GCACCCCTCTTCTGAGACACAGG + Intergenic
1096492104 12:52018655-52018677 CCTCCCCACCTCTGAGCCCCAGG + Intergenic
1096499494 12:52056272-52056294 CCACCCCACCTCTGAACCCCAGG + Intronic
1100411024 12:94320022-94320044 GCACCCAACATAGGAGCACCCGG - Intronic
1104455452 12:128907817-128907839 GTACCACACATTTGAGCCCCGGG - Intronic
1108503054 13:51085374-51085396 GCACCCCATTTATTTGCCCAAGG - Intergenic
1124618820 15:31262393-31262415 GCACACCTCTTCTGAGTCCCAGG - Intergenic
1124654609 15:31498219-31498241 GCACCCCACATATGGGTGCCAGG + Intronic
1125766874 15:42142103-42142125 GAACTTCACCTATGAGCCCCAGG - Exonic
1126780324 15:52134032-52134054 GCAGCACCCTTATGGGCCCCTGG - Intronic
1127893934 15:63277944-63277966 AAACCCCACCCATGAGCCCCAGG - Intronic
1129117704 15:73374572-73374594 GGACTCCACCTGTGAGCCCCTGG + Intergenic
1137444207 16:48522055-48522077 GCACCCCACCCATCTGCCCCTGG - Intergenic
1143768465 17:9152640-9152662 GCACCCCACTTCTGAATTCCAGG + Intronic
1146656361 17:34637461-34637483 GGACCCCACTTATGACTACCCGG + Exonic
1151348360 17:73516929-73516951 CCACCCCACTTATGATTCCCTGG - Intronic
1152691002 17:81717607-81717629 GCACCCCACTTATGAGCCCCAGG - Intronic
1153928958 18:9861344-9861366 GCTACCCACTAATGAGCCCATGG + Exonic
1157060300 18:44280415-44280437 GCAGCTGACTTATGAACCCCAGG - Intergenic
1158863493 18:61615815-61615837 GCACCCTTCATATTAGCCCCCGG + Intergenic
1159291312 18:66425172-66425194 GCCTCCCACCTCTGAGCCCCTGG - Intergenic
1160406108 18:78647337-78647359 GGACCCCATTTCTGAGCCCTGGG + Intergenic
1163791054 19:19306289-19306311 GCGGCCCACTTCAGAGCCCCAGG - Intronic
1164541194 19:29122608-29122630 CCACCCCACCTATGCTCCCCAGG - Intergenic
928181375 2:29071151-29071173 CCAGCCCACCTGTGAGCCCCAGG - Exonic
931642591 2:64394957-64394979 GTACACCACTGATGAACCCCTGG - Intergenic
931721302 2:65069543-65069565 GCTCCCCACTCATGGGCCCTGGG - Exonic
933772533 2:85753590-85753612 GCACGTGACTTATGGGCCCCCGG - Intronic
942424513 2:175845782-175845804 ACACCCCACATATGACCCTCAGG + Intergenic
942527222 2:176867240-176867262 CCACCCCACTCACTAGCCCCTGG - Intergenic
946566914 2:220976306-220976328 AGACCTCACTTCTGAGCCCCAGG - Intergenic
947899733 2:233711401-233711423 GCACCCTCCTGATGAGCCCGGGG - Intronic
947909849 2:233793832-233793854 GCACCCCTCTTAGGAGGGCCTGG + Intronic
1172687883 20:36770864-36770886 GCACCCCACCTGTGATGCCCTGG + Exonic
1180706409 22:17812970-17812992 GCACCCCACTTCTACTCCCCCGG - Intronic
1180743865 22:18073608-18073630 CCATCCCACTGATGAGCCTCTGG + Intergenic
1180984829 22:19898119-19898141 GCACCCCACAGATGTGGCCCTGG - Exonic
1181465419 22:23108120-23108142 GCTCCCCACCTGTGTGCCCCTGG - Intronic
1183769688 22:39913238-39913260 GGACACCAGGTATGAGCCCCAGG + Intronic
951627663 3:24683701-24683723 GCATCACACCTATGAGTCCCAGG - Intergenic
962343913 3:134606243-134606265 GCACCCCACACAGCAGCCCCAGG + Intronic
970322010 4:14884130-14884152 AAAGCCCATTTATGAGCCCCAGG - Intergenic
972979431 4:44678154-44678176 GCTCCCCACCTGTGAGCTCCTGG + Intronic
978390383 4:108219090-108219112 GCACCCCACTTCTGGGCTCCTGG - Intergenic
980489019 4:133500727-133500749 GCAGCAGAATTATGAGCCCCTGG + Intergenic
994284524 5:97948856-97948878 GCAGCCAACTTAAGAGCACCTGG + Intergenic
997884435 5:137617271-137617293 GCACACCACTTAATACCCCCTGG + Intergenic
999346578 5:150827119-150827141 TCACCCCACTACTGAGTCCCAGG - Intergenic
1001809445 5:174616689-174616711 TCCCCTCACTTGTGAGCCCCAGG + Intergenic
1002909896 6:1481778-1481800 TCACCCATCTTCTGAGCCCCTGG + Intergenic
1003729021 6:8799529-8799551 ACACCCCACATATGACCCTCAGG - Intergenic
1015185658 6:130412653-130412675 GCACCCCACTTTTGGTCACCAGG + Intronic
1019552546 7:1610393-1610415 GCTGCCCACTCGTGAGCCCCCGG + Intergenic
1020323575 7:6957717-6957739 GCTCCCCACTTTTGAGTCCACGG - Intergenic
1030138443 7:106282090-106282112 GTACCCCACTCATGAGGCTCAGG + Intronic
1033990201 7:147273514-147273536 CCACCCCACTTTGGAGTCCCCGG + Intronic
1035609997 8:955503-955525 GATCCCCATTTCTGAGCCCCGGG + Intergenic
1038312537 8:26455533-26455555 GCCCCCCAATTATCACCCCCTGG - Intronic
1044483047 8:92715562-92715584 GCATCCCAAATATTAGCCCCTGG + Intergenic
1044716247 8:95102457-95102479 GCCCCCCACTCCTGACCCCCTGG + Intronic
1049247617 8:141571226-141571248 CCACCCCACTGGGGAGCCCCTGG - Intergenic
1050955515 9:11652841-11652863 TCCCCCCACTTCTTAGCCCCAGG + Intergenic
1061724754 9:132575983-132576005 GCACCACACTTATGTGCACCTGG + Intergenic
1062389052 9:136326920-136326942 GCCCCCCACCTCTGAGACCCTGG - Intergenic
1062466887 9:136685551-136685573 GCACCTGACTTAGGAGACCCTGG - Intronic
1190333013 X:49247483-49247505 TCACTCCCCTTAGGAGCCCCAGG + Exonic
1199414897 X:147570582-147570604 GCACCCCACAAATTAGCCCATGG + Intergenic