ID: 1152691007

View in Genome Browser
Species Human (GRCh38)
Location 17:81717628-81717650
Sequence GCCAGGGCTTTGGGAGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9906
Summary {0: 1, 1: 0, 2: 17, 3: 468, 4: 9420}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152691000_1152691007 0 Left 1152691000 17:81717605-81717627 CCCCTGGGGCTCATAAGTGGGGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152690998_1152691007 1 Left 1152690998 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152691001_1152691007 -1 Left 1152691001 17:81717606-81717628 CCCTGGGGCTCATAAGTGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 85
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152691002_1152691007 -2 Left 1152691002 17:81717607-81717629 CCTGGGGCTCATAAGTGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420
1152690992_1152691007 20 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691007 17:81717628-81717650 GCCAGGGCTTTGGGAGCTCATGG 0: 1
1: 0
2: 17
3: 468
4: 9420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152691007 Original CRISPR GCCAGGGCTTTGGGAGCTCA TGG Intronic
Too many off-targets to display for this crispr