ID: 1152691009

View in Genome Browser
Species Human (GRCh38)
Location 17:81717629-81717651
Sequence CCAGGGCTTTGGGAGCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 504}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152691000_1152691009 1 Left 1152691000 17:81717605-81717627 CCCCTGGGGCTCATAAGTGGGGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152690992_1152691009 21 Left 1152690992 17:81717585-81717607 CCTTGGGCATCTGGCAGTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 277
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152690998_1152691009 2 Left 1152690998 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152691001_1152691009 0 Left 1152691001 17:81717606-81717628 CCCTGGGGCTCATAAGTGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 85
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504
1152691002_1152691009 -1 Left 1152691002 17:81717607-81717629 CCTGGGGCTCATAAGTGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152691009 Original CRISPR CCAGGGCTTTGGGAGCTCAT GGG Intronic
900161640 1:1226891-1226913 CCAGGCCTTCGTGAGCTCAGGGG + Intronic
900637123 1:3671454-3671476 CCAGGGCCTAGGCAGCTCTTGGG + Intronic
900698317 1:4026875-4026897 GCTGGGCTTTGGGAGCTCATGGG + Intergenic
901232681 1:7649965-7649987 CCAGGTAGTTGGGAGCTCAGAGG + Intronic
901626518 1:10628180-10628202 CCAGCACTTTGGGAGGCCATGGG - Intronic
902519609 1:17008699-17008721 CCAGCCCTTTGGGAGCCCAAGGG + Intronic
902972647 1:20065426-20065448 CCAGGGGTTTGGGAGGACAGAGG - Intronic
903035620 1:20490874-20490896 GCAGGGCTTTGGGGGCTCTTTGG - Intergenic
903654938 1:24943236-24943258 CCAGGGCTTTGGGAGCATGCTGG + Intronic
904128322 1:28258365-28258387 CAAGTGCCTTGGGAGCTCAGGGG + Intergenic
904337059 1:29804789-29804811 ACAGGGCTTTGAGAACACATAGG + Intergenic
904719138 1:32493508-32493530 CCAGCACTTTGGGAGGTCAACGG + Exonic
904768872 1:32870277-32870299 GCAGGGCTTTGAGAGGTCCTGGG + Intronic
905165425 1:36079378-36079400 CCAGCACTTTGGGAGGTCAAAGG + Intergenic
906391762 1:45423306-45423328 CCAGGACTTTGGGAGACCAAGGG + Intronic
906568990 1:46820346-46820368 CCAGTGATTTGGGAGGTCAGGGG + Intergenic
906586458 1:46983331-46983353 GCAGGGAATTGGGAGCTCACAGG + Intergenic
907189998 1:52640512-52640534 CCAGCACTTTGGGAGGTCAAGGG + Intronic
908624007 1:66019600-66019622 CCAGCACTTTGGGAGGTCAAGGG - Intronic
908862573 1:68506364-68506386 CCAGCACTTTGGGAGGCCATAGG - Intergenic
910259957 1:85284904-85284926 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
910260513 1:85289388-85289410 CCAGGACTTTGGGAGGCCAAGGG - Intergenic
910931646 1:92448365-92448387 CCAGTGCTTTGGGAGGCCAAAGG - Intergenic
911939024 1:104018861-104018883 CCACGGCTTTGAGAGAACATAGG - Intergenic
912547676 1:110462767-110462789 CCAGGGCTTGAGGATCTCCTGGG - Intergenic
913101327 1:115569957-115569979 CCTGGACTTAGGCAGCTCATGGG - Intergenic
914838846 1:151230971-151230993 CCAGAGCTTTGGGAGTTCTGAGG + Intronic
915295709 1:154920099-154920121 CCAGCACTTTGAGAGCTCAAGGG - Intergenic
916426024 1:164681012-164681034 CCAGCACTTTGGGAGGCCATGGG + Intronic
918241094 1:182621060-182621082 ACAGAGCTGTGGGAGCACATGGG + Intergenic
918684990 1:187403314-187403336 CCAGCACTTTGGGAGGTCAACGG + Intergenic
919226235 1:194707383-194707405 CATGGGCTTTGGGTGCCCATTGG - Intergenic
919941498 1:202289810-202289832 CCAGGCCTTTGGGAGATAAAAGG + Intronic
920452854 1:206073153-206073175 CCAGGCCTTTGGGATCTCCTTGG + Intronic
921042690 1:211448757-211448779 CCAGGGCCTTGAGAGAACATAGG + Intergenic
921348708 1:214213440-214213462 ACTGGGCTATGGGAGCTCAGAGG + Intergenic
922685401 1:227634851-227634873 CCAGGGCTTTGAGAAAACATAGG + Intronic
923413129 1:233729768-233729790 CCAGCACTTTGGGAGCACTTTGG + Intergenic
924239656 1:242028936-242028958 CCAGCACTTTGGGAGCACTTTGG - Intergenic
924544421 1:245011964-245011986 CCAGCACTTTGGGAGGTCACGGG + Intronic
924789781 1:247235275-247235297 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1063796147 10:9516062-9516084 GCAGGCCTCTGTGAGCTCATAGG + Intergenic
1064267109 10:13834006-13834028 CCAGGACTTTGGGAGGCCACGGG + Intronic
1067104002 10:43353012-43353034 CCAGCACTTTGGGAGGCCATAGG - Intergenic
1067975199 10:51016914-51016936 CCAGCACTTTGGGAGCCCAAAGG - Intronic
1068068407 10:52164099-52164121 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1069561699 10:69435359-69435381 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1069997670 10:72352980-72353002 CCAGGTCTTTGTCAGCTCAGTGG + Intronic
1070146115 10:73774428-73774450 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1070393136 10:75988726-75988748 CCTGGGCCTTGGGAGCACTTGGG - Intronic
1071523652 10:86346039-86346061 CCAGGGGTGTGGGAGCACAGGGG - Intronic
1072412472 10:95216296-95216318 TGAGGCCTTTGGGAGGTCATTGG - Intronic
1073143702 10:101265278-101265300 CCAGGGGTTTGGGATCTCTTTGG - Intergenic
1073624501 10:105082986-105083008 CCAGCACTTTGGGAGCACTTTGG - Intronic
1073678922 10:105680448-105680470 CCAGGGCTTTGAGAAAACATAGG + Intergenic
1073899485 10:108203703-108203725 CCAGTGGTCTGGGAGCACATTGG - Intergenic
1074373745 10:112922084-112922106 CCAGCACTTTGGGAGGTCAAAGG + Intergenic
1075280056 10:121131350-121131372 CCAGAGCATTGAGAGCTCTTTGG + Intergenic
1075951991 10:126486891-126486913 CCAGGACTTTGGGAGGCCAAGGG + Intronic
1076132794 10:128025651-128025673 CCAGGGTTTGGGGAGTTCCTGGG - Intronic
1076879510 10:133232991-133233013 CCAGGTCTTTGGGAGGCCAGAGG + Intergenic
1078243031 11:9547806-9547828 CCAGTGCTTTGGGAGGCCAAGGG + Intergenic
1078991704 11:16654419-16654441 CCAGCACTTTGGGAGGTCAAGGG - Intronic
1078994946 11:16687532-16687554 CCAGCACTTTGGGAGCACTTTGG - Intronic
1079981793 11:27158838-27158860 CCAGCACTTTGGGAAGTCATAGG - Intergenic
1081633015 11:44702099-44702121 CCAGGGCTGTGGGAGGCCATGGG - Intergenic
1081644779 11:44782295-44782317 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1081792364 11:45797263-45797285 CCAGTGCTTAGAGAGCTCACAGG + Intergenic
1083151831 11:60796533-60796555 CCAGCACTTTGGGAGGCCATGGG - Intronic
1083236396 11:61353616-61353638 CAAGGGCTGTGGGAGGTCAGTGG - Intronic
1083259830 11:61516972-61516994 CCAGGGCGTGGGGAGACCATTGG - Intronic
1083705676 11:64512645-64512667 CCAGTGGTTTGGGAGGTCAAGGG + Intergenic
1083913432 11:65724342-65724364 CCAGCACTTTGGGAGCCCAAGGG - Intergenic
1084019174 11:66407556-66407578 CCAGCGTTTTGGGTGTTCATAGG - Intergenic
1084656246 11:70520848-70520870 CGTGGTCTTTGGGAGCTCCTTGG + Intronic
1085472911 11:76769442-76769464 CCAAGGCTTTGGGAGGCTATAGG - Intergenic
1085620706 11:78035908-78035930 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1087877034 11:103370458-103370480 CCAGGGCCTTGAGTGATCATAGG + Intronic
1088230643 11:107670408-107670430 CCAGCGGTTTGGGAGCTGAGTGG + Intergenic
1088651225 11:111959276-111959298 CCCTGGCTTGGGGAGCTCCTAGG - Intronic
1089182751 11:116594379-116594401 CCAGGGCTGTGGGAGCAGAGAGG + Intergenic
1091266117 11:134272249-134272271 CCAGCGCTTTGGGAGACCAGAGG - Intergenic
1091490430 12:927614-927636 CCAGCCCTTTGGGAGGTCAAGGG + Intronic
1093957340 12:25236074-25236096 CCAGGGTTTGGGGATCTCAAAGG + Intronic
1095149214 12:38771207-38771229 CCAGCGCTTTGGGAGGGCAAGGG + Intronic
1095944531 12:47746495-47746517 CCAGTGCTGTGGGAGCTCAGAGG - Intronic
1096550806 12:52370419-52370441 GGAAGGCTTTGTGAGCTCATCGG + Intergenic
1097015505 12:55983907-55983929 CCAGGGGTTTGGGAGATAAAAGG - Intronic
1097500328 12:60393062-60393084 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1098259421 12:68652958-68652980 CCAGCACTTTGGGAGGTCAAAGG + Intronic
1099325779 12:81213202-81213224 ATGGGGCTTTGGGAGTTCATAGG + Intronic
1099427700 12:82544886-82544908 CCAGGACTTTGGGAGACCAAGGG - Intergenic
1100162103 12:91872422-91872444 CCAGGACTTTGGGAGGCCAAGGG + Intergenic
1102480070 12:113216825-113216847 ACAGGACTTTGGGAGCACTTTGG + Intronic
1102638104 12:114342252-114342274 ACAGGGCTTTGGGAGCACTCCGG + Intergenic
1103272150 12:119682206-119682228 CCAGGGCTTGGAGAACTCATGGG - Intergenic
1103345050 12:120243787-120243809 ACAGTGCTTTGGGAACTCAAAGG - Intronic
1103475556 12:121215786-121215808 CCAGAACTTTGGGAGGTCAAGGG - Intronic
1103646838 12:122400505-122400527 GAAGGGCTTTGGGGGCACATGGG + Intronic
1104332782 12:127862878-127862900 GCAGCACTTTGGGAGCTCAAGGG - Intergenic
1104450576 12:128865197-128865219 GCTGGGCTTTGGGAGTTCACAGG - Intronic
1104738132 12:131152572-131152594 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1104805623 12:131587553-131587575 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1104890973 12:132140044-132140066 CTGGGGCTTTGTGAGCTCCTGGG - Intronic
1105015282 12:132782968-132782990 CCAGCACTTTGGGAGGTCAGGGG + Intronic
1105759670 13:23502572-23502594 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
1106135802 13:26972450-26972472 CCAGGGATTTGGAAGGCCATGGG + Intergenic
1106365419 13:29074354-29074376 CCAGAGCTGTGGGAGCACACAGG - Intronic
1108275756 13:48807932-48807954 CCAGGACTTTGGGAGGCCAAGGG + Intergenic
1108590998 13:51912732-51912754 TCACGGCTTTGGAAGCTCAAGGG + Intergenic
1112175606 13:97020575-97020597 CAGGAGCTTTGGGTGCTCATGGG - Intergenic
1112340647 13:98550287-98550309 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1113137719 13:107112524-107112546 CCAGTGCTTTGGGAGGCCAAGGG - Intergenic
1113383643 13:109827610-109827632 CCAGGACTTTGGGAGGCCAAGGG - Intergenic
1113559662 13:111268292-111268314 CCGGGGCTTAGAGAGCTCAGAGG + Intronic
1115300359 14:31878614-31878636 CCAGCACTTTGGGAGGCCATGGG - Intergenic
1115485084 14:33902340-33902362 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1115580373 14:34751939-34751961 CCAGCACTTTGGGAGTTCAAGGG + Intergenic
1116840815 14:49819662-49819684 CCAGCACTTTGGGAGACCATAGG - Intronic
1116866472 14:50035783-50035805 CCAGGACTTTGGGAGGCCAAGGG - Intergenic
1117258840 14:54007904-54007926 TCAGGCCTTTTGGAGCTCCTAGG + Intergenic
1119672125 14:76527849-76527871 CCAGGGCCTTGGGGCCTCAGTGG + Intergenic
1120451101 14:84667842-84667864 CCAGAACTTTGGGAGGCCATGGG - Intergenic
1120590117 14:86364691-86364713 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1120916066 14:89711386-89711408 CCAGCCCTCTAGGAGCTCATGGG - Intergenic
1120927990 14:89817264-89817286 CCAGTGCTTTGGGAGGCCAAGGG + Intronic
1121065225 14:90957312-90957334 CCAGCACTTTGGGAGGCCATGGG - Intronic
1121132400 14:91460260-91460282 CCAGTGCTTTGGGAGGTCCAGGG - Intronic
1121280337 14:92692930-92692952 CCAGGGCTCAGAGGGCTCATTGG + Intergenic
1121429284 14:93875538-93875560 CCAGGGCTCTGGGAGGTGATGGG - Intergenic
1121562272 14:94884501-94884523 CCAGGGCTTCAGGAGCCCAGAGG - Intergenic
1121657987 14:95612192-95612214 CCAGGACTTTGGGAGGCCAAGGG - Intergenic
1121945260 14:98114653-98114675 CCAGGCCTGTGGGAGCTCTGGGG + Intergenic
1122415051 14:101545377-101545399 CCGGGGCTAAGGGAGCACATGGG + Intergenic
1124820956 15:33045040-33045062 CCCTGGCTTGGGGAGCTCCTAGG - Intronic
1125218117 15:37302368-37302390 CCAGCACTTTGGGAGGTCAAAGG + Intergenic
1126163497 15:45634873-45634895 CCAGGGCGTTGAGCGCTCACGGG - Exonic
1126716771 15:51525934-51525956 CCAGGGCTTTGAGAGAACATAGG + Intronic
1126793181 15:52239198-52239220 CCAGCACTTTGGGAGGCCATGGG - Intronic
1127513977 15:59673678-59673700 CCAGTGCTTTGGGAGGCCAAAGG - Intronic
1128750442 15:70144944-70144966 GCAGGGCTAAGGGAGCTCAGAGG + Intergenic
1128993856 15:72282251-72282273 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1129183635 15:73892429-73892451 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1129705891 15:77794046-77794068 CGGGGGCATTGGGAGCTCAGTGG - Intronic
1129758962 15:78116829-78116851 CCAGTGCTTTGGGAGGCCAAGGG + Intronic
1130157814 15:81368180-81368202 CCAGTGCTTTGGGAGGCCAAGGG - Intronic
1130781052 15:87041736-87041758 CCAGGGCATTGGATTCTCATAGG + Intergenic
1132080817 15:98864006-98864028 CCAGCACTTTGGGAGGCCATAGG + Intronic
1132484664 16:184404-184426 CTTGGGCTTGGGGAGCGCATGGG - Intergenic
1132597532 16:760263-760285 TCAGGGCTGTGGGAGCACACAGG - Intronic
1132602405 16:779544-779566 CCAGGGCTTTGGCACCTGCTGGG + Intronic
1133796940 16:9053644-9053666 CCAGCACTTTGGGAGGTCAGGGG + Intergenic
1133822965 16:9253222-9253244 CCAGGGATTGGGGAACTGATGGG - Intergenic
1133874299 16:9719070-9719092 CCAGCACTTTGGGAGGCCATAGG + Intergenic
1133992779 16:10722412-10722434 CGTGGGCTTTGGGAAGTCATAGG + Intergenic
1134063812 16:11213973-11213995 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1134128140 16:11630370-11630392 TCAGGGCTTTAGGACATCATTGG - Intronic
1134415596 16:14040862-14040884 CCAGCGCTTTGGGAGACCAAAGG + Intergenic
1135140516 16:19917427-19917449 AAAGGGCTCTGGGAGCTCAGAGG + Intergenic
1135755162 16:25091320-25091342 CCCCACCTTTGGGAGCTCATGGG + Intergenic
1135792018 16:25405679-25405701 CCAGGGTTTTGGGAGGCCAAGGG + Intergenic
1136267955 16:29131930-29131952 CCAGAGCCTTGTGGGCTCATGGG + Intergenic
1136482318 16:30549982-30550004 CCAGCACTTTGGGAGCCCAATGG - Intronic
1137627055 16:49915803-49915825 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1138122887 16:54414672-54414694 CCAGTGCTTTGGGAGCCTGTAGG + Intergenic
1138356397 16:56384471-56384493 CCAGTGCTTTGGAAGGTCATTGG - Intronic
1138787624 16:59865668-59865690 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1139401109 16:66682089-66682111 CAAGAGCTCTGGGAGCTCTTTGG + Intronic
1139432713 16:66919660-66919682 TAAGGACTTCGGGAGCTCATAGG - Intergenic
1140726173 16:77814616-77814638 ACAGGGCCTTGGGAAATCATTGG + Intronic
1141089864 16:81122752-81122774 CCAGCACTTTGGGAGGCCATTGG - Intergenic
1142071262 16:88092268-88092290 CCAGAGCCTTGTGGGCTCATGGG + Intronic
1142202533 16:88768065-88768087 ACATGGCTTTGGGGGCTCGTGGG - Intronic
1142701706 17:1666298-1666320 CCAGCACTTTGGGAGCCCAGGGG + Intronic
1143584907 17:7846160-7846182 CCAGGGCTTTGGGAACAGCTTGG + Exonic
1143646728 17:8235069-8235091 CCAGGGCCTTGGTAGCCCACAGG + Exonic
1144106559 17:11991622-11991644 CCAGGGTTTTAGGAGCTCTGCGG - Intronic
1146286362 17:31576751-31576773 CCAAGGCTTTTGGAGGTCCTGGG + Intergenic
1146425386 17:32732846-32732868 CCCTGGCTTGGGGAGCTCCTAGG - Intronic
1146786932 17:35729254-35729276 CCAGCACTTTGGGAGGTCAAGGG - Intronic
1146939216 17:36832522-36832544 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1147984056 17:44294352-44294374 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
1147995140 17:44356056-44356078 CCAGGGCTGTGGGTGCGCAATGG - Exonic
1148165177 17:45478713-45478735 CCAGAACTTTGGGAGGTCAGAGG + Intronic
1148489230 17:48012542-48012564 CCAAGGCTGTGGGAGCTGAAGGG - Intergenic
1149292801 17:55233746-55233768 CCATAACATTGGGAGCTCATAGG - Intergenic
1149438020 17:56650568-56650590 CCAGGTCTTGGGGAGCACAAAGG - Intergenic
1149557676 17:57585749-57585771 TCAGGGCTTTCTGAGCTCAGGGG - Intronic
1150576122 17:66432561-66432583 CTACGGCTTAGGGAGGTCATGGG + Intronic
1150740870 17:67778230-67778252 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1150815331 17:68388180-68388202 CCAGGGCTTTGGCAGCACATGGG + Intronic
1151546811 17:74798420-74798442 CAAGGGCTTTGGGAGGCCACTGG - Intronic
1152691009 17:81717629-81717651 CCAGGGCTTTGGGAGCTCATGGG + Intronic
1153012306 18:550001-550023 CCAGAGCTTTGGGAGATCAAGGG - Intergenic
1153427900 18:4987059-4987081 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1154286159 18:13058687-13058709 TCAGGGCTGTGGGACCTCAGCGG + Intronic
1156315812 18:35967713-35967735 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1156445690 18:37235280-37235302 CCAGTACTCTGGGAGCTCCTGGG - Intergenic
1156473196 18:37390287-37390309 CCAGGGCTCTGGGAGCTGTCGGG - Intronic
1157042822 18:44060585-44060607 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1157146961 18:45173574-45173596 CCAGGTGTTTGGGTGCTGATGGG + Intergenic
1157179090 18:45479832-45479854 CCAGACCTTTGGGGGCTCAGAGG - Intronic
1157558113 18:48626592-48626614 CCAGCACTTTGGGAGGCCATGGG - Intronic
1158788101 18:60740365-60740387 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1159580296 18:70228191-70228213 CCAGGTCTTTGGTAACTCAATGG - Intergenic
1160136315 18:76274549-76274571 CCACCGCATTGGAAGCTCATGGG + Intergenic
1160187650 18:76688011-76688033 CCAGCACTTTGGGAGGCCATGGG + Intergenic
1160427802 18:78790327-78790349 CCAGGGCGTTGGGAGCTCCAGGG + Intergenic
1160880384 19:1316928-1316950 CCAAGGCTTTGGGAGGTGAGGGG + Intergenic
1161540113 19:4845518-4845540 CCAGCGCTTTGGGAGGCCAAGGG + Intronic
1161922716 19:7278607-7278629 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1162020900 19:7868075-7868097 CCAGCGCTTTGGGAGGCCAAGGG + Intergenic
1162511157 19:11119411-11119433 CCAGCACTTTGGGAGGTCAGAGG + Intronic
1162603044 19:11684326-11684348 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1162892052 19:13740782-13740804 CCAGCACTTTGGGAGCCCAAGGG - Intronic
1163159871 19:15458099-15458121 GCAGGGCTTTGGGTGCATATGGG + Intronic
1163183145 19:15618056-15618078 CCAGGGCTTTGTGAGGTGGTTGG + Exonic
1163395957 19:17061604-17061626 CCATGGCATTGCGAGCACATGGG + Intronic
1163445509 19:17343795-17343817 CCAGCACTTTGGGAGGCCATAGG + Intergenic
1163479674 19:17547600-17547622 CCAGCACTTTGGGAGCCCAAGGG - Intronic
1163500816 19:17675076-17675098 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1163602813 19:18258934-18258956 CCAGTCCTCTGGGAGCTGATGGG - Intronic
1163689054 19:18728763-18728785 CCAGAACTTTGGGAGGTCTTTGG - Intronic
1165117047 19:33534840-33534862 CCAGTACTTTGGGAGGCCATGGG + Intergenic
1166086293 19:40477594-40477616 CAAGGACTGTGGGAGCCCATAGG + Intronic
1166139196 19:40796802-40796824 CTCAGGCTTTGGGAGCTCTTGGG - Exonic
1166461874 19:42994899-42994921 CAAGGGCTTTGGGACCTGAGTGG + Intronic
1166479153 19:43154860-43154882 CAAGGGCTTTGGGACCTGAAAGG + Intronic
1166785085 19:45362816-45362838 CCAGGGCCTTTGGAGCCCACAGG + Intronic
1167174656 19:47857512-47857534 CCAGGGCTTTGGGAGTCAAGGGG - Intergenic
1167320790 19:48796206-48796228 CCAGGGCTCCGGGAGCTCCCAGG + Intronic
1168261667 19:55198563-55198585 AAAGGACTTTGGGAGCTCCTTGG - Intronic
1202632785 1_KI270706v1_random:15713-15735 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1202653094 1_KI270707v1_random:24336-24358 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
925082572 2:1081684-1081706 CCACGGCTCTGGGAGCTCACGGG - Intronic
925249567 2:2421192-2421214 CCAGGGCTTTGGGCAAACATAGG - Intergenic
926358608 2:12064312-12064334 CCAGGGCTTCGGGAGCACAGAGG - Intergenic
926554634 2:14342309-14342331 CCCTGGCTTGGGGAGCTCCTTGG - Intergenic
927270516 2:21204675-21204697 CCAGGACTTAGGGAGCTCTCAGG + Intergenic
927468049 2:23351610-23351632 CCAGGGCTTTGGGGCTTCCTGGG - Intergenic
927601525 2:24446490-24446512 CCAGTGCTTTGGGAGGCCAAGGG - Intergenic
927842837 2:26456358-26456380 GCAGGGCTTTGGAGGCCCATGGG + Intronic
929235684 2:39603271-39603293 GCAGAGATTTGGGGGCTCATTGG - Intergenic
929523088 2:42673101-42673123 CCAGCACTTTGGGAGGTCAGAGG - Intronic
930022897 2:47012156-47012178 CCAGGCCTATGGGGGCTCTTGGG + Intronic
930712955 2:54566435-54566457 CCAGGACTTTGGGAGGCCAAGGG - Intronic
930727496 2:54695867-54695889 CCAGGGCTTTGAGTGAACATAGG + Intergenic
930889174 2:56362870-56362892 CCAGCACTTTGGGAGGTCAAGGG - Intronic
932453380 2:71830546-71830568 CCAGGGCTTTTGTAGTTCAGAGG + Intergenic
933881652 2:86675680-86675702 CCAGGGCTCTGTGTGCTAATAGG - Intronic
934149679 2:89134482-89134504 CCAAGGCTGTGGGAGCTGACAGG + Intergenic
934217618 2:90047546-90047568 CCAAGGCTGTGGGAGCTGACAGG - Intergenic
934747310 2:96767820-96767842 CTAGCACTTTGGGAGCTCTTTGG + Intronic
935817665 2:106861880-106861902 CCAGTGCTTTGGGAGGCCAAAGG - Intronic
936109448 2:109652958-109652980 CCAGGACTTTGCTAGCTCATAGG - Intergenic
936478518 2:112863625-112863647 ACATGGCTGAGGGAGCTCATAGG - Intergenic
937642470 2:124229207-124229229 CTAGGGTTGGGGGAGCTCATAGG - Intronic
937973509 2:127567152-127567174 CCAGGGACTTGGGAGGTCAAAGG + Intronic
937975847 2:127581727-127581749 CCAGGGCCCTGGGAGCTGTTAGG - Intronic
938261065 2:129895412-129895434 CCAGGGGTTAGGGGGCTCAGAGG - Intergenic
939829813 2:147058294-147058316 CCTGGGCTCTGGGAACTCTTAGG - Intergenic
940320973 2:152376142-152376164 CCAGCACTTTGGGAGGTCAAGGG - Intronic
940764574 2:157775970-157775992 CCAGCACTTTGGGAGCCCAAGGG - Intronic
941394688 2:164959784-164959806 CCAAGGCTTTGGGAGCAGTTTGG - Intergenic
941938836 2:171011241-171011263 CCAGGGCTTTGGGAGATGGGAGG - Intronic
942136327 2:172929820-172929842 ACAGGGATTTAGGAGCTCTTAGG + Intronic
942325198 2:174770415-174770437 CCAGTGCTTTGGGAGGCCAAGGG + Intergenic
942734608 2:179096186-179096208 CCAGGGCTTTGAGTGAACATAGG - Intergenic
942832750 2:180256013-180256035 CCAGGGCTATGTGATTTCATGGG + Intergenic
944590611 2:201214001-201214023 CATGGGCTTTGGGAAGTCATAGG + Intronic
945779810 2:214155253-214155275 CCAGGCCTGTGTGAGCTCCTGGG - Intronic
946074577 2:217063429-217063451 ACAGGGCTTTGGGGGATCCTGGG + Intergenic
946734707 2:222742833-222742855 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
946816123 2:223580245-223580267 CCAGCGCTTTGGGAGGCCAATGG - Intergenic
946910930 2:224459803-224459825 CCTGAGATTTGGAAGCTCATGGG + Intergenic
947280187 2:228443423-228443445 CGTGGGCTTTGGGAACTCAAGGG - Intergenic
947542814 2:230990502-230990524 CGAGGGCCTGGGGAGCTGATCGG - Intergenic
948189189 2:236045163-236045185 CCAGCACTTTGGGAGGTCAATGG - Intronic
948323041 2:237086132-237086154 AGCGGGCTTTGGGAGCTCACGGG + Intronic
948496714 2:238354896-238354918 CCAGCGCTTTGGGAGGCCAAGGG - Intronic
948723494 2:239918256-239918278 CCAGGGCTGTGGGACCTCAGTGG - Intronic
948843925 2:240674042-240674064 CCTGTGCTTGTGGAGCTCATAGG + Intergenic
948849887 2:240700593-240700615 CCTGTGCTTGTGGAGCTCATAGG - Intergenic
1169144015 20:3240776-3240798 CCAGGTGTTTGGGAGCTGCTGGG - Intergenic
1169715252 20:8609008-8609030 CTAGGGCTTTCGGAGCTAAGGGG + Intronic
1170420022 20:16183623-16183645 CAGGGTCTTTGGGAGGTCATTGG + Intergenic
1171126666 20:22608160-22608182 TGAGGGCTTTGTGAGCTCATAGG + Intergenic
1171947667 20:31392791-31392813 CCAGGGCTTTGGGAGGCCAAGGG + Intergenic
1172132069 20:32662347-32662369 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
1172166980 20:32905511-32905533 CCAGCACTTTGGGAGGCCATGGG + Intronic
1172243454 20:33429094-33429116 CCAGGACTTTGGGAGGCCTTAGG + Intronic
1172497587 20:35399604-35399626 CCAGCACTTTGGGAGACCATAGG + Intronic
1172761395 20:37325759-37325781 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
1172989455 20:39022403-39022425 CCAGCACTTTGGGAGGTCAAGGG - Intronic
1173006990 20:39147543-39147565 CCAGCACTTTGGGAGGTCAAAGG + Intergenic
1173624287 20:44460416-44460438 CCAGTACTTTGGGAGGTCAAAGG + Intronic
1173819838 20:46012841-46012863 CCAGGGCTTTGGGAGACCCAAGG + Intronic
1174010583 20:47446467-47446489 CCAGCACTTTGGGAGCACTTTGG + Intergenic
1174319204 20:49727301-49727323 CCAGCACTTTGGGAGGTCAAAGG + Intergenic
1174915754 20:54652039-54652061 CCAGGGCCTTGGCAGCCAATGGG + Intergenic
1175097657 20:56554299-56554321 CCAGCACTTTGGGAGCCCAAGGG + Intergenic
1175683761 20:61011096-61011118 CCTGGGGTTTGGGGGCTCCTTGG + Intergenic
1175684910 20:61021800-61021822 CCAGGGCTTTGAAAATTCATCGG + Intergenic
1175864726 20:62169193-62169215 ACTTGGCTTTGGCAGCTCATGGG - Intronic
1176599059 21:8775315-8775337 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1176644998 21:9341593-9341615 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1177369167 21:20179716-20179738 CCAGGGCTTTGAGAGCAGAAGGG - Intergenic
1179206390 21:39284228-39284250 CCAGTGCTTTGGGAGGCCAATGG + Intronic
1180367953 22:11957641-11957663 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1180378136 22:12113695-12113717 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1180419372 22:12799586-12799608 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1180614129 22:17116921-17116943 CCAGGGAAGTGGCAGCTCATTGG + Exonic
1180957042 22:19745849-19745871 GCAGGGCTCTGGGAGCTCCCAGG - Intergenic
1181888537 22:26040945-26040967 CCAGGACTGAGGGAGCTCTTGGG + Intergenic
1182312562 22:29419553-29419575 CCAGCGCTTTGGGAGGTCGAGGG + Intronic
1182471160 22:30549116-30549138 CCAGCACTTTGGGAGGTCGTGGG + Intergenic
1182757642 22:32692737-32692759 ACAGGGCTTTGGGAAGTGATGGG - Intronic
1183279109 22:36922745-36922767 CCAGGTCTCTGGGAGCCCTTGGG - Intronic
1183439358 22:37814721-37814743 CCAGGACTTTGGGAGCTTACGGG - Intronic
1183594746 22:38803996-38804018 CCAGAACTTTGGGAGGCCATGGG + Intergenic
1184128174 22:42501934-42501956 CCATGGATTTCGGAGGTCATGGG + Intergenic
1184136964 22:42555247-42555269 CCATGGATTTCGGAGGTCATGGG + Exonic
1184326873 22:43795016-43795038 ACAGGGCCTGGGGAGCTCCTTGG - Intronic
1184333039 22:43838057-43838079 CCATGGCTTTGGGAGGTCCTGGG - Intronic
1184365670 22:44049693-44049715 CCAGGGCTATGGCAGCCCCTAGG - Intronic
1185048997 22:48543962-48543984 CCAGGCCCCTGGGAGCTCCTCGG - Intronic
1185343668 22:50302272-50302294 TCAGGGCTTTGGGAGGCCAGAGG + Intronic
949782992 3:7710988-7711010 TCAGGGCTGTGGGAGTACATAGG - Intronic
949856224 3:8463828-8463850 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
949924422 3:9029890-9029912 CCAGGACTTTGGGAGGCCCTTGG + Intronic
950177708 3:10886839-10886861 CAAGGGCTTTGTTAGGTCATAGG - Intronic
950430376 3:12947553-12947575 CCAGGGCTTTGGGGGATGCTTGG - Intronic
952083726 3:29792987-29793009 CCAGCGCTTTGGGAGGCCAAGGG + Intronic
952719119 3:36514098-36514120 CCAGGGCAATGGGAGGACATTGG - Intronic
953002746 3:38950494-38950516 CAGGGGCCTTGGGAGCTGATTGG + Exonic
953518445 3:43619598-43619620 CCAGCACTTTGGGAGTCCATGGG + Intronic
953643143 3:44728287-44728309 CCAGCACTTTGGGAGGCCATGGG - Intergenic
954547097 3:51446247-51446269 CCAGCTCTTTGGGAGCTGAGTGG - Intronic
955064509 3:55522990-55523012 CCAGGACTTTGGGATTTAATAGG - Intronic
956972190 3:74539110-74539132 CCAGGTCTGTGGGAGACCATAGG - Intergenic
957636421 3:82791237-82791259 CCCTGGCTCTGGGAGCTCCTAGG - Intergenic
958800118 3:98745281-98745303 CTAGGACTTTGGGAGGTCAAGGG - Intronic
960012070 3:112844675-112844697 CCAGCACTTTGGGAGCTGAGGGG + Intronic
960991724 3:123315832-123315854 CCAGCGCTTTGGGAGGCCAAGGG - Intronic
961042783 3:123689127-123689149 CCAGGGCTTTGTGACCACAGAGG - Intronic
961525890 3:127497115-127497137 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
961811304 3:129523341-129523363 CCAGTGCTGTGGGAGCCCAGAGG - Intergenic
961837210 3:129672346-129672368 CCAGTGCTTTGGGAGGTCAAAGG + Intronic
962239866 3:133743358-133743380 CCAGGGCTTTGCCAGCACAGGGG - Intergenic
962485679 3:135840001-135840023 CAAAGGCCTTGGGAGCTAATAGG - Intergenic
964282331 3:155080054-155080076 CCAGGGCGCTGGGAGCCCGTGGG + Intronic
965924211 3:173958098-173958120 CCCTGGCTTGGGGAGCTCCTAGG + Intronic
966434482 3:179868186-179868208 CAAAGGCTTTAGGAGCTAATGGG + Intronic
967435581 3:189442415-189442437 CCAGCACTTTGGGAGGCCATCGG + Intergenic
968000405 3:195201774-195201796 CCATGGCTTTGGGACCTTCTAGG - Intronic
968132275 3:196198641-196198663 CCAGGGCACTGGGAGCTCTGGGG - Intronic
968271557 3:197407260-197407282 AGAGGGCTCTGGGAGCTCCTCGG + Intergenic
1202741893 3_GL000221v1_random:63475-63497 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
968508718 4:985358-985380 CCAGGGCACTGGGAGCTCTGAGG - Intronic
968711933 4:2125780-2125802 TCAGTGCTTTTGGAGCTCAGTGG + Intronic
968797558 4:2717902-2717924 CCAGGACTTTGGGAGGCCAAGGG - Intronic
969255015 4:5995561-5995583 CCAGGGCTGTGGGAACCCAGAGG - Intergenic
969288802 4:6225551-6225573 CCAGGGCCTTGGGAGCTCTCCGG + Intergenic
969659003 4:8515537-8515559 CCAGGGCTGTGGGAGCCCAGAGG + Intergenic
969814032 4:9673310-9673332 CCAGGACTTTGGGAGGCCAAAGG + Intergenic
971357448 4:25907779-25907801 CCAGCGCTTTGGGAGGCCAAGGG + Intronic
971823722 4:31593650-31593672 CCAGCACTTTGGGAGGCCATTGG - Intergenic
972149651 4:36073272-36073294 CCAGTGCTTTGGGAACTGATGGG - Intronic
972908939 4:43789095-43789117 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
973339886 4:48993331-48993353 CCAGGGGTCTGGGGGCTCAGCGG - Intronic
973362414 4:49177687-49177709 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
973398687 4:49619174-49619196 CCCTGGCTTAGGGAGCTCCTAGG - Intergenic
974260203 4:59517401-59517423 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
974696845 4:65387313-65387335 CCATGGCTTTGGAAACTGATAGG + Intronic
976170129 4:82294843-82294865 CCAGCACTTTGGGAGGCCATGGG + Intergenic
977816165 4:101416357-101416379 CCCTGGCTTGGGGAGCTCCTAGG + Intronic
978169522 4:105652406-105652428 CCAGGGTTATGAGAGCACATAGG + Intronic
978498544 4:109385109-109385131 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
978775263 4:112499391-112499413 CCAGCACTTTGGGAGGTCAAAGG - Intergenic
979056229 4:115998420-115998442 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
981392325 4:144205740-144205762 CCAGGGCTGTGGTAGCAAATGGG - Intergenic
981705311 4:147653196-147653218 CCAGCACTTTGGGAGGTCAAGGG + Intronic
981735643 4:147947650-147947672 CCAGGACTTTGGGAGGCCAAAGG - Intronic
981950243 4:150397525-150397547 CCAGTGCTTTGGGAGGCCAAGGG - Intronic
982773311 4:159418005-159418027 CCAGCACTTTGGGAGGTCTTGGG + Intergenic
983017320 4:162628980-162629002 CCAGGGCTTTGAGTGAACATAGG + Intergenic
983492001 4:168399285-168399307 CCATGGCTTGGGGAGCTCCTAGG - Intronic
984319195 4:178170050-178170072 CCAGGACTTTGGGAGGCCAAGGG + Intergenic
984555879 4:181213390-181213412 CCAGTGCTTTGGGAGGCCAAGGG - Intergenic
984647568 4:182235747-182235769 CCAGGGTTTTTGTATCTCATTGG - Intronic
1202759753 4_GL000008v2_random:99160-99182 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
986401102 5:7381734-7381756 CCAGAACTTTGGGAGGTCACTGG - Intergenic
987748325 5:22006226-22006248 CCAGGGGTTTGGGACCACCTTGG - Intronic
988664245 5:33307871-33307893 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
988728184 5:33944223-33944245 CCAGGACTTTGGGAGGCCAAGGG + Intergenic
990172283 5:53065879-53065901 CCAGTACTTTGGGAGGTCCTTGG + Exonic
990424377 5:55671568-55671590 CCAGCACTTTGGGAGCACAGTGG + Intronic
991594548 5:68288999-68289021 CCAGGGCTTGGAGAGACCATGGG + Intronic
991768500 5:70016014-70016036 CCAGGGGTTTGGGACCACCTTGG - Intergenic
991847738 5:70891096-70891118 CCAGGGGTTTGGGACCACCTTGG - Intergenic
992551864 5:77866752-77866774 CAAGGGCTATGAGAGCACATGGG + Intronic
993234120 5:85280679-85280701 CCAGGACTTTGGGAGGCCAAGGG + Intergenic
993278775 5:85898183-85898205 CCAGGTCTTTGAGAGAACATAGG - Intergenic
994584519 5:101689254-101689276 CAAGGACTTTGGTAGCTAATGGG + Intergenic
994902033 5:105785859-105785881 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
995149254 5:108823114-108823136 CCAGGACTTTGGGAGGCCAAGGG - Intronic
995863059 5:116661759-116661781 CCATGGCTCAGGGAGCTCCTGGG - Intergenic
996371006 5:122752375-122752397 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
997042718 5:130277375-130277397 CCCTGGCTTAGGGAGCTCCTAGG + Intergenic
997180953 5:131828411-131828433 CCAGCACTTTGGGAGGTCAAAGG - Intronic
997207089 5:132056428-132056450 CCAGGGCTTTGGCAGACCCTGGG + Intergenic
997961754 5:138327364-138327386 CCAGGACTTTGGGAGGCCAAGGG + Intronic
998429687 5:142060271-142060293 CCAGCACTTTGGGAGATCAAGGG - Intergenic
999002435 5:147939262-147939284 CCAGGGCTTTGAGTGAACATAGG - Intergenic
999298651 5:150476494-150476516 CCAGCACTTTGGGAGGTCAAGGG + Intergenic
999987432 5:157017250-157017272 CCAGAGCTTTGGGAGGCCAAGGG + Intergenic
1000005373 5:157178124-157178146 CCAGCACTTTGGGAGGTCAAGGG - Intronic
1000266352 5:159641626-159641648 CCCTGGCTTAGGGAGCTCCTAGG - Intergenic
1000399566 5:160811831-160811853 CCAGGGCCTTGAGCGCACATAGG + Intronic
1001677934 5:173534015-173534037 GGAGAGCTTTGGGAGCTCTTTGG + Intergenic
1002865890 6:1122026-1122048 CGAGGGCTCTGGGAGTTCAAAGG + Intergenic
1003102728 6:3189342-3189364 CCAGCGCTTTGGGAGGCCAGTGG - Intergenic
1004180491 6:13376793-13376815 TGAGGGCTTTGGGAGATGATAGG - Intronic
1004936758 6:20515436-20515458 CTATGGCTTAGAGAGCTCATTGG + Intergenic
1006091797 6:31632716-31632738 CCAAGGCTGTGGGAACTCCTGGG + Exonic
1006558416 6:34889018-34889040 CAAAGGTTTTGGGAGCTCCTGGG - Intergenic
1006759462 6:36446535-36446557 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1006825652 6:36933533-36933555 CCAGTGCTTTGGGAGGCCAAGGG + Intergenic
1007704561 6:43782970-43782992 CCCGGGCTTACGGAGCTCACAGG - Intronic
1008076926 6:47155057-47155079 CCAGAGCTTTAGGAGCTATTAGG - Intergenic
1008322915 6:50139857-50139879 CCAGCGCTTTGGGAGGCCAAGGG - Intergenic
1009575003 6:65442503-65442525 CCAGCACTTTGGGAGGTCAGGGG + Intronic
1010925108 6:81735328-81735350 CCAGCACTTTGGGAGCCCAAGGG - Intronic
1011502112 6:88002100-88002122 CCAGCACTTTGGGAGGTCAGAGG + Intergenic
1011528532 6:88294160-88294182 CCAGCACTTTGGGAGCCCAAGGG - Intergenic
1013550400 6:111202224-111202246 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1014031357 6:116709034-116709056 CCAGAGTTTTGGGAGGTCAAGGG - Intronic
1014357296 6:120428686-120428708 CCAGCACTTTGGGAGGCCATGGG + Intergenic
1014517268 6:122395211-122395233 CCAGAGCTATAGGAGCACATGGG + Intergenic
1015663814 6:135604456-135604478 CCCTGGCTTGGGGAGCTCACAGG - Intergenic
1016457964 6:144250745-144250767 CAGGTGCTTTGGGAGCTCAGTGG - Intergenic
1017624887 6:156338345-156338367 CCAGCACTTTGGGAGGCCATGGG - Intergenic
1019703492 7:2486497-2486519 CCAGCACTTTAGGAGGTCATGGG - Intergenic
1020135520 7:5585896-5585918 TCAGGGCTTTGGGCCCTCTTGGG + Intergenic
1020761322 7:12270539-12270561 CCTTGGCTTAGGGAGCTCCTAGG - Intergenic
1021034891 7:15785434-15785456 CCAGGGCCTTGAGAGAACATAGG + Intergenic
1021097335 7:16548433-16548455 CCCTGGCTTGGGGAGCTCCTAGG - Intronic
1022861635 7:34373505-34373527 GCAGGGCTTTGGGAGTTATTGGG - Intergenic
1023528965 7:41133834-41133856 ACAGGGCTTTGGCAGATCATTGG - Intergenic
1023910494 7:44552202-44552224 CCAGTGCTTTGGGAGGCCAAGGG + Intergenic
1024808097 7:53172197-53172219 CCAAAACTTTGGGACCTCATGGG - Intergenic
1027173693 7:75889995-75890017 CCCGCCCTTGGGGAGCTCATTGG + Intergenic
1027916973 7:84337241-84337263 CCAGGTCTTTGGGAATTTATTGG - Intronic
1028596118 7:92547482-92547504 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1029293369 7:99519524-99519546 CCAGCACTTTGGGAGGTCAAGGG - Intronic
1029379948 7:100206728-100206750 CCAGCACTTTGGGAGCACTTTGG - Intronic
1030266699 7:107629075-107629097 CCAGGGCTTTGGTGGCTACTCGG - Intronic
1030271339 7:107671408-107671430 CCAGTGCTTTGGGAAGCCATAGG - Intronic
1030348431 7:108457370-108457392 CCAGCGCTTAGTGAGCTCAGCGG + Intergenic
1032271910 7:130416760-130416782 CAAGGGCTGTGGGAGATCCTGGG - Intronic
1033196399 7:139331373-139331395 ACAGGGTTTTGGGAGCTTCTGGG - Intergenic
1034937979 7:155211959-155211981 CCAGGGCAGTGAGGGCTCATGGG + Intergenic
1035334031 7:158114192-158114214 CCAGGGCTCTGGGACCTGAGTGG + Intronic
1037235490 8:16715110-16715132 CCTGGGCTTTTGGTGCTGATTGG + Intergenic
1037247672 8:16855119-16855141 CCAGCACTTTGGGAGCCCAGGGG + Intergenic
1037308879 8:17534212-17534234 CCAGGTCTTTGGGATTTCCTTGG + Intronic
1037492365 8:19408407-19408429 CCAGTGCTTTGGGAGGTTAGAGG - Intronic
1037675355 8:21046252-21046274 CCACGGATTGGGGAGCTCTTTGG - Intergenic
1037938315 8:22929950-22929972 CCAGCACTTTGGGAGCACACAGG - Intronic
1038123199 8:24641623-24641645 CCAGTGCTTTCGGAGGTCATGGG + Intergenic
1038551408 8:28472483-28472505 CCAGCACTTTGGGAGGTCAAGGG + Intronic
1039164751 8:34665400-34665422 CCAGGGCTTTGGGAGGCCAAGGG - Intergenic
1039181802 8:34875173-34875195 CCAGAACTTTGGGAGGTCAACGG + Intergenic
1039493251 8:37963645-37963667 CCAGGGTTTTGGGAGCTCCAGGG - Exonic
1039584106 8:38691226-38691248 CCTGAGCTTTGGGAGCTGTTTGG - Intergenic
1040005457 8:42617143-42617165 CCAGGACTTTGGGAGGCCAAGGG - Intergenic
1041468704 8:58184434-58184456 CCAGTGCTTTGGGAGGCCAAGGG + Intronic
1043109899 8:76167968-76167990 CCAGCGCTTTGGAAGGTCAAGGG + Intergenic
1043806316 8:84676465-84676487 CAAGGGATTTGGGAGCACACTGG - Intronic
1044524716 8:93239633-93239655 CCAGGGCTTGGGGAGCTCTACGG - Intergenic
1044813851 8:96090658-96090680 CCAGGGCTTTGTGAGCTATGAGG + Intergenic
1046211259 8:111080399-111080421 CCAGGGCTTTGAGTGAACATAGG - Intergenic
1046503671 8:115110992-115111014 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1048185335 8:132235247-132235269 CCAGGACTTTGGGAGGCCAAGGG + Intronic
1048717893 8:137288007-137288029 CCAGGGCTCTGTGTTCTCATGGG + Intergenic
1049273501 8:141708273-141708295 CCAGGGCCCTGGGAGCTCCAGGG + Intergenic
1049639180 8:143706861-143706883 CGAGGGCTCTGGGATCTCTTCGG - Exonic
1049687481 8:143944704-143944726 CCAGGGGTGTGGGAGGTCACAGG + Intronic
1050256337 9:3796010-3796032 CCAGAGTTTTGAGAGCCCATTGG - Intergenic
1050531284 9:6591838-6591860 CCAGCACTTTGGGAGGTCAGGGG - Intronic
1050539557 9:6658445-6658467 CCAGCACTTTGGGAGGTCAACGG - Intergenic
1051338885 9:16092967-16092989 ACAAGGCTGTGGGAGTTCATGGG + Intergenic
1051644392 9:19252985-19253007 CCAGCACTTTGGGAGGTCACAGG - Intronic
1055010235 9:71557632-71557654 GCAGGGCTTTGGGACTTCATTGG - Intergenic
1055091447 9:72367678-72367700 CCAGCACTTTGGGAGGCCATGGG + Intergenic
1055460276 9:76513017-76513039 CCAGGACTTTGGGAGGCCAAGGG - Intergenic
1055606902 9:77979593-77979615 CTGGGGCTTTGGGACCTCAGAGG - Intronic
1056450536 9:86712505-86712527 CCAGTGCTCAGGGAGGTCATGGG - Intergenic
1056984210 9:91346350-91346372 ACAGGGCTTAGGGAGCTCCCAGG + Intronic
1057292273 9:93814279-93814301 AGAGGGCTTAGGGAGCTCAAGGG - Intergenic
1058904280 9:109469086-109469108 CCAGGGCTCTGGTGTCTCATGGG - Intronic
1060123292 9:121017198-121017220 CCTGTGCTTTGGGAGCTGACAGG + Intronic
1060267031 9:122117863-122117885 CCAGAGCTTTGGGAGGCCAAGGG + Intergenic
1060425173 9:123498642-123498664 CCAGGGCTTTGGGGTCCAATGGG + Intronic
1060740803 9:126096451-126096473 CCAGGGCTATGGGAGCAGAAGGG + Intergenic
1061125141 9:128670189-128670211 CCAGCACTTTGGGAGCCCAAGGG + Intergenic
1061664439 9:132152195-132152217 GCAGGGCCTTGGGAGCCCAAGGG - Intergenic
1062116529 9:134812336-134812358 CCGGGGCTTCGGGGGCTCAGTGG + Intronic
1062640669 9:137516392-137516414 CCAGGGCCGGGGGTGCTCATGGG - Intronic
1203691544 Un_GL000214v1:47375-47397 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1203710523 Un_KI270742v1:93399-93421 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1203540529 Un_KI270743v1:84055-84077 CCCTGGCTTGGGGAGCTCCTAGG + Intergenic
1203644751 Un_KI270751v1:56816-56838 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1186476452 X:9861417-9861439 CCAGTGCTTTGGGAGGCCAATGG - Intronic
1186855864 X:13625421-13625443 CCAGCACTTTGGGAGCACTTTGG + Intronic
1187997043 X:24938162-24938184 CCAGCACTTTGGGAGCACTTTGG + Intronic
1188207856 X:27381406-27381428 CCCTGGCTTGGGGAGCTCCTAGG - Intergenic
1188756605 X:33970045-33970067 CCCTGGTTTGGGGAGCTCATAGG - Intergenic
1188786421 X:34352222-34352244 CCAGTGCTTTGGGAGGTTAACGG + Intergenic
1189686724 X:43572358-43572380 CCAGCACTTTGGGAGCTCCGAGG + Intergenic
1190309358 X:49105828-49105850 CCAGGGCTTTGGGAGGTTGACGG + Intergenic
1190361035 X:49648442-49648464 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
1190614690 X:52217932-52217954 CCAGGGCTTTGAGTGAACATAGG + Intergenic
1190652509 X:52581153-52581175 CCAGCACTTTGGGAGGTCAAGGG - Intergenic
1192266845 X:69544404-69544426 CCAGGGCAATGGGAAGTCATGGG - Intergenic
1193455404 X:81725344-81725366 CCAGGGCCTTGGGTGAACATAGG + Intergenic
1194323109 X:92477108-92477130 CCAGGGCCTTGGGAAAACATAGG - Intronic
1194787538 X:98105819-98105841 CCAGGGCTTTGAGCAATCATAGG - Intergenic
1195968789 X:110452781-110452803 CCAGGATCTTGGGTGCTCATTGG - Exonic
1195971415 X:110477795-110477817 CCAGGGCTTTGAGTGAACATAGG - Intergenic
1196789025 X:119447555-119447577 CCAGCACTTTGGGAGGCCATAGG - Intronic
1198430713 X:136564228-136564250 CCAGGGCTTTGAGTGAACATAGG - Intergenic
1200402584 X:156028076-156028098 CCAGGCCTTTGAGAGGTCACAGG - Intergenic
1200631208 Y:5590265-5590287 CCAGGGCCTTGGGAAAACATAGG - Intronic
1201780560 Y:17716766-17716788 CCCTGGCTTTGAGAGCTCCTAGG + Intergenic
1201820994 Y:18189224-18189246 CCCTGGCTTTGAGAGCTCCTAGG - Intergenic
1202039520 Y:20667509-20667531 CCAGCACTTTGGGAGCTGAGGGG + Intergenic