ID: 1152692874

View in Genome Browser
Species Human (GRCh38)
Location 17:81728438-81728460
Sequence CCAGCTCTAGCTGGTTTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152692866_1152692874 17 Left 1152692866 17:81728398-81728420 CCGAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG No data
1152692861_1152692874 27 Left 1152692861 17:81728388-81728410 CCTCGGCCTCCCGAAGTGCTGGG 0: 1851
1: 120775
2: 266467
3: 220261
4: 244205
Right 1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG No data
1152692865_1152692874 18 Left 1152692865 17:81728397-81728419 CCCGAAGTGCTGGGATTACAGGC 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877
Right 1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG No data
1152692863_1152692874 21 Left 1152692863 17:81728394-81728416 CCTCCCGAAGTGCTGGGATTACA 0: 5020
1: 297851
2: 269720
3: 207813
4: 298339
Right 1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG No data
1152692868_1152692874 -10 Left 1152692868 17:81728425-81728447 CCACCGCACCTGGCCAGCTCTAG No data
Right 1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152692874 Original CRISPR CCAGCTCTAGCTGGTTTTAC GGG Intergenic
No off target data available for this crispr