ID: 1152695480

View in Genome Browser
Species Human (GRCh38)
Location 17:81741754-81741776
Sequence GACCCGGGTGTGGCCGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152695480_1152695487 25 Left 1152695480 17:81741754-81741776 CCAGGCGCGGCCACACCCGGGTC No data
Right 1152695487 17:81741802-81741824 ACCAGCCCCATCTCGGCCGAGGG No data
1152695480_1152695485 18 Left 1152695480 17:81741754-81741776 CCAGGCGCGGCCACACCCGGGTC No data
Right 1152695485 17:81741795-81741817 GTCTCTGACCAGCCCCATCTCGG No data
1152695480_1152695486 24 Left 1152695480 17:81741754-81741776 CCAGGCGCGGCCACACCCGGGTC No data
Right 1152695486 17:81741801-81741823 GACCAGCCCCATCTCGGCCGAGG No data
1152695480_1152695484 -4 Left 1152695480 17:81741754-81741776 CCAGGCGCGGCCACACCCGGGTC No data
Right 1152695484 17:81741773-81741795 GGTCACACACACACACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152695480 Original CRISPR GACCCGGGTGTGGCCGCGCC TGG (reversed) Intergenic
No off target data available for this crispr