ID: 1152696622

View in Genome Browser
Species Human (GRCh38)
Location 17:81800829-81800851
Sequence ATTGCAGGGGGCCCTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152696622_1152696630 -8 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696630 17:81800844-81800866 CCTGCAATGAGTAGGACCCTGGG No data
1152696622_1152696635 6 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696635 17:81800858-81800880 GACCCTGGGGACTGGATGGAGGG No data
1152696622_1152696632 -2 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696632 17:81800850-81800872 ATGAGTAGGACCCTGGGGACTGG No data
1152696622_1152696631 -7 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696631 17:81800845-81800867 CTGCAATGAGTAGGACCCTGGGG No data
1152696622_1152696628 -9 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696628 17:81800843-81800865 CCCTGCAATGAGTAGGACCCTGG No data
1152696622_1152696633 2 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696633 17:81800854-81800876 GTAGGACCCTGGGGACTGGATGG No data
1152696622_1152696638 10 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696638 17:81800862-81800884 CTGGGGACTGGATGGAGGGCAGG No data
1152696622_1152696634 5 Left 1152696622 17:81800829-81800851 CCTCCAGGAGGGCCCCCTGCAAT No data
Right 1152696634 17:81800857-81800879 GGACCCTGGGGACTGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152696622 Original CRISPR ATTGCAGGGGGCCCTCCTGG AGG (reversed) Intergenic