ID: 1152700003

View in Genome Browser
Species Human (GRCh38)
Location 17:81814009-81814031
Sequence CCTGCTTTCCAGGACATGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 209}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152700003_1152700020 27 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700020 17:81814059-81814081 GGGGATGGAACAGCGGTGGGTGG 0: 1
1: 0
2: 2
3: 32
4: 358
1152700003_1152700018 23 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700018 17:81814055-81814077 AGTGGGGGATGGAACAGCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 241
1152700003_1152700011 5 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700011 17:81814037-81814059 AAATGCTGGGGCCGAAGCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 198
1152700003_1152700019 24 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700019 17:81814056-81814078 GTGGGGGATGGAACAGCGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 237
1152700003_1152700015 12 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700015 17:81814044-81814066 GGGGCCGAAGCAGTGGGGGATGG 0: 1
1: 1
2: 3
3: 47
4: 430
1152700003_1152700009 -8 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700009 17:81814024-81814046 AAAGCAGGGCTGGAAATGCTGGG 0: 1
1: 0
2: 1
3: 22
4: 325
1152700003_1152700008 -9 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700008 17:81814023-81814045 GAAAGCAGGGCTGGAAATGCTGG 0: 1
1: 0
2: 3
3: 40
4: 417
1152700003_1152700013 7 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700013 17:81814039-81814061 ATGCTGGGGCCGAAGCAGTGGGG 0: 1
1: 0
2: 2
3: 7
4: 163
1152700003_1152700010 -7 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700010 17:81814025-81814047 AAGCAGGGCTGGAAATGCTGGGG 0: 1
1: 0
2: 0
3: 31
4: 360
1152700003_1152700017 20 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700017 17:81814052-81814074 AGCAGTGGGGGATGGAACAGCGG 0: 1
1: 0
2: 3
3: 38
4: 434
1152700003_1152700012 6 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700012 17:81814038-81814060 AATGCTGGGGCCGAAGCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1152700003_1152700014 8 Left 1152700003 17:81814009-81814031 CCGTGCATGTCCTGGAAAGCAGG 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1152700014 17:81814040-81814062 TGCTGGGGCCGAAGCAGTGGGGG 0: 1
1: 0
2: 3
3: 23
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152700003 Original CRISPR CCTGCTTTCCAGGACATGCA CGG (reversed) Exonic
900081496 1:861545-861567 CGAGCTGTCCAGGAGATGCATGG - Intergenic
902150326 1:14437760-14437782 CCAGGTTTCAAAGACATGCACGG + Intergenic
903182283 1:21610982-21611004 CCTGGACTCGAGGACATGCAAGG - Intronic
903194364 1:21673771-21673793 CCTGCTTTCAAGGACTTGGAGGG - Intergenic
904042771 1:27593836-27593858 CCTGCATCCCAGGACTTGCTGGG + Intronic
905252145 1:36656380-36656402 CCTGCTTTCCAGGACCAGCCAGG - Intergenic
905884082 1:41482399-41482421 CCTGCTCCCCAGGGCATGCCCGG + Intronic
906040925 1:42787279-42787301 CCTACTTTCCAGGTAAAGCAAGG - Intronic
907300352 1:53482960-53482982 CCTGCTTGGCATGACATTCAAGG - Intergenic
907968788 1:59360429-59360451 ACTGCTTCCCAGGACATGGGAGG - Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
912159761 1:106967472-106967494 CCTGCTTTCCAGACCATGCCTGG - Intergenic
912296103 1:108472545-108472567 CTTGCTTTCAGTGACATGCATGG + Intergenic
912738725 1:112173981-112174003 ACTCCTTTCCTGGACCTGCAGGG - Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
916245012 1:162678643-162678665 TCTGCCCTCCAGGACAAGCATGG - Intronic
916785822 1:168086457-168086479 CCTACTTTCCAGAAAATGTAAGG - Intronic
918787404 1:188780471-188780493 CCTGCTTCTCATCACATGCATGG + Intergenic
923552220 1:234973095-234973117 CCAGTTTTCCAGGACATTAAGGG + Intergenic
923873144 1:238018315-238018337 ACTGCTTTCCATCACATTCATGG - Intergenic
1062928786 10:1338846-1338868 CCTGCCCTCCAGCCCATGCAAGG - Intronic
1063320254 10:5045685-5045707 CCTGCTTTGCAGGTCTTTCAGGG + Intronic
1067474920 10:46558540-46558562 CCTCCTTGCCAGGGCATGAATGG - Intergenic
1070825530 10:79388341-79388363 CCTGCTTTCCTGGACGTCCCAGG + Intronic
1073146027 10:101282528-101282550 CCTCCATGCCAGGACATGCAGGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074947309 10:118293651-118293673 CCTGCTCTCCAGCACATACCTGG + Intergenic
1075602341 10:123779235-123779257 CATGCTTTCTAGCACATGCTGGG + Intronic
1076690881 10:132223408-132223430 GTTGCTTCCCAGGCCATGCATGG - Intronic
1076744903 10:132507974-132507996 CCTGATGTCCAGGCCATGCCCGG + Intergenic
1077225037 11:1435934-1435956 CCTGCTGTCCAGGACGTGGGAGG + Intronic
1077313287 11:1902888-1902910 CCTGCTTTTTAGGCCATACAGGG + Intergenic
1077364973 11:2158001-2158023 CCAGCCTTCCAGGACTTGCAGGG - Intronic
1078153664 11:8779852-8779874 GCTGCATTCCATGACATGCAAGG - Intronic
1079142970 11:17825531-17825553 GGTACTTTCCAGGACATTCAGGG - Intronic
1080115160 11:28614072-28614094 CATGGTTTCCAGGCCATGGAGGG + Intergenic
1081651304 11:44825869-44825891 CAGGCCTTACAGGACATGCAAGG + Intronic
1083191763 11:61057209-61057231 CCTGTTTCCCAGGAACTGCAGGG - Intergenic
1083731976 11:64657196-64657218 CTTGCTCCCCAGGACTTGCAGGG - Intronic
1085257492 11:75184013-75184035 CTACCTTTCCAGGACATGCCAGG - Intronic
1085911358 11:80830566-80830588 CCTGCTTTCAATGAAATACACGG - Intergenic
1087944289 11:104139567-104139589 ACTGCTTTCAAGTAGATGCAGGG + Intronic
1088304029 11:108389274-108389296 CCTTCTTTCCAGCACATTTATGG - Intronic
1089067763 11:115674905-115674927 CCTGCTTTCTCAGTCATGCAGGG + Intergenic
1090628966 11:128629587-128629609 CCTGTTTTACAGGATATGGAGGG - Intergenic
1091286097 11:134409394-134409416 CCTGCATTCCAGGACCAGGAGGG + Intronic
1091613122 12:2028533-2028555 CCTTTTATCCAGGACAAGCATGG + Intronic
1092943190 12:13429371-13429393 CCTGTCTTCCAGGACAAGGAGGG + Intergenic
1094038367 12:26095323-26095345 CCTGCTTTCCAGGACCCACCTGG - Intergenic
1094375292 12:29783301-29783323 CCTCCTCTCCAGGATGTGCATGG - Intronic
1096244308 12:49975704-49975726 CCTGCCTTGCAGGACCTGCCTGG + Exonic
1096993304 12:55822288-55822310 CCTGCTTTTTAGGACACCCAGGG - Intronic
1101830502 12:108253079-108253101 CCTGGTTTCCAGGCCAGGCATGG - Intergenic
1104196450 12:126543723-126543745 CCTCCTTTCAAGGACAGACATGG - Intergenic
1104718735 12:131033081-131033103 CCTGCCCTCCAGGACATTCATGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1108484609 13:50910722-50910744 CCGGCCATCCAGGACATGCGAGG + Intronic
1109219144 13:59623783-59623805 CCTGCTTACCAGGACTTGTAAGG + Intergenic
1111924199 13:94445710-94445732 CATGGTTACCAGCACATGCAGGG + Exonic
1112352831 13:98650765-98650787 CATGAATTCCAAGACATGCAAGG + Intergenic
1113336410 13:109380482-109380504 CGTGCTTTCAAGGTCATTCACGG + Intergenic
1115426169 14:33262427-33262449 GCAGCATTCCAGGACCTGCAAGG + Intronic
1116203739 14:41834022-41834044 CCTGCTTTCCAGGGAAAGCAAGG + Intronic
1118292047 14:64535832-64535854 CCTGCTCTCCAGTATTTGCAAGG - Intergenic
1119719501 14:76881753-76881775 CCTGCTACCCAGCCCATGCAGGG + Intergenic
1119848174 14:77846433-77846455 CCTGGCTTCCAGGACAGTCATGG - Intronic
1120732923 14:88023077-88023099 CCTACTCTCCAGGGCAGGCATGG - Intergenic
1121313734 14:92948960-92948982 CCGGCTTTGCAGGACACACAGGG + Intronic
1121382731 14:93488749-93488771 CCTGCTTTCTAGTTCATGGATGG + Intronic
1121911600 14:97797026-97797048 GCTGCTTTCCTGAATATGCATGG + Intergenic
1121949724 14:98160898-98160920 CCAGCTTTCCAAGCCAAGCAGGG + Intergenic
1124226861 15:27902591-27902613 CCAGGTTCCCAGGACACGCAGGG + Intronic
1124809057 15:32916165-32916187 CCTGCTTTAGGGCACATGCAAGG + Intronic
1127166212 15:56246266-56246288 CCGGCCTTCCAGGACCTACAGGG + Intronic
1127753686 15:62069068-62069090 GGTGCTTTCCACAACATGCATGG + Exonic
1129468589 15:75738122-75738144 CCTTCTTTCCAGCACTTGCATGG - Intergenic
1129533181 15:76286671-76286693 CCTGCTTTTAAAGACATCCAGGG - Intronic
1129726991 15:77906385-77906407 CCTTCTTTCCAGCACTTGCATGG + Intergenic
1129832617 15:78680664-78680686 CCCGCTTTCCAGCAGGTGCAAGG - Intronic
1130485955 15:84398703-84398725 CCTTCTGTCCAGCACTTGCATGG - Intergenic
1132322989 15:100940710-100940732 CCAGCTTTCCAGCACCTCCAGGG - Intronic
1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG + Exonic
1135742180 16:24985391-24985413 AATGCCTTCCTGGACATGCAAGG + Intronic
1136988376 16:35135054-35135076 GCTGCTTTCAAGTACATGCATGG + Intergenic
1137823898 16:51472725-51472747 ACTGCTTGCCAGGAGTTGCAGGG - Intergenic
1138547354 16:57727758-57727780 CCTGCTCTCCAGCACAGGGAGGG + Intronic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1141856159 16:86682793-86682815 CCTGCCCTCCACCACATGCAGGG + Intergenic
1143434592 17:6914258-6914280 CCGGCTTTGCAGGACAGGGAAGG + Intronic
1143581400 17:7829440-7829462 CTTACTTTCCTGGAGATGCAAGG - Intronic
1143650883 17:8263788-8263810 CCAGATTTCCAGGGCATTCAGGG - Exonic
1143873726 17:9976221-9976243 GCTGCTTTCCAGGACATCAGAGG + Intronic
1143973859 17:10815590-10815612 GCTGCTTTCTGGGACAGGCAGGG - Intergenic
1149836913 17:59921336-59921358 CTTGCTTTCAAGGACAAGGAAGG - Intronic
1150144372 17:62755375-62755397 TCTCCTTTCCAGGACACGAAGGG - Intronic
1150301568 17:64051534-64051556 TCTGGTTTCCAGGAAATACAAGG + Intronic
1151280102 17:73067298-73067320 CCTGCTGTGCAGGACTTTCAGGG + Intronic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1152723531 17:81934379-81934401 CCCACTCTCCAGCACATGCAAGG + Exonic
1152891316 17:82883205-82883227 CCTGGTTTCCAGGTCTTCCAGGG - Intronic
1153394193 18:4599441-4599463 TCTGCTTTTCAGGACTTTCAAGG - Intergenic
1155154903 18:23149964-23149986 TCTGCTATCCAGGTAATGCAGGG + Intronic
1156056436 18:33010330-33010352 CCTGCTTTCCATGACCGCCAGGG - Intronic
1157333445 18:46720278-46720300 TCAGCTTCCCAGGACAAGCATGG + Intronic
1159542839 18:69801613-69801635 ACTGCTTTCCAGGACTTTTAAGG + Intronic
1160246390 18:77163541-77163563 CCTGGCGTCCAGGACAGGCAGGG + Intergenic
1161469494 19:4449200-4449222 CCTGCTTCCCAGGCCATGGGTGG - Intronic
1161515186 19:4692537-4692559 GCTGCTGTCTAGGAGATGCATGG + Intronic
1161854905 19:6758751-6758773 CCTGCATCCCAGGCCCTGCACGG - Intronic
1162593633 19:11610218-11610240 CGTTCTTTCCTGGACATGAAGGG + Intronic
1164920990 19:32088677-32088699 CCTGCTCTCCAGCACATTCTCGG - Intergenic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1166073139 19:40398125-40398147 CCTGCTTTCCTGGGCACTCATGG - Intronic
1166178785 19:41092685-41092707 TCTGCTAACCAGGACATGAACGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1168149695 19:54438959-54438981 CCTGCTTTTCATGACCTTCACGG + Intergenic
925032055 2:658559-658581 CCTCGGTTCCAGGAAATGCAGGG - Intergenic
928259947 2:29757457-29757479 CCTTCCTTACAGGACATGAAAGG - Intronic
929532628 2:42762314-42762336 TCTGCCTTTCAGGACATGCCGGG + Intergenic
930623980 2:53675894-53675916 CCTGCATTGCAGGGCATGGAGGG + Intronic
931853359 2:66276069-66276091 CCAGCTTTCCAGGACAGCCTGGG + Intergenic
931881256 2:66573878-66573900 CCTCCTCTCCAGTACATGCCCGG + Intergenic
933615322 2:84477510-84477532 CCTCCTTTCAAGTACATGCTGGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
936159138 2:110070863-110070885 CCTGCTCTCCAGAACCTGGAAGG - Intergenic
936185523 2:110300469-110300491 CCTGCTCTCCAGAACCTGGAAGG + Intergenic
937198203 2:120179322-120179344 CGTGCCTTCCAGGATATGCTGGG - Intergenic
941582382 2:167315494-167315516 CCTGCTTTTCAGGGCTGGCAGGG + Intergenic
942223647 2:173795700-173795722 GCTGCTTTCTAGGACTTACATGG - Intergenic
942274369 2:174308621-174308643 ACTGCTTATCAGCACATGCACGG - Intergenic
942680463 2:178473062-178473084 CATGCATTTCAAGACATGCAGGG + Intronic
945859751 2:215107200-215107222 GCTGCTTGCCTGGACATTCATGG + Intronic
947167034 2:227273060-227273082 CCTGGTCTCCAGGGCACGCAAGG + Exonic
947819561 2:233060529-233060551 GCTGCTTTCCAGGACAGGCAAGG + Exonic
947942398 2:234069650-234069672 CCTGCCCTCCAGGGCATCCATGG + Intronic
948134825 2:235628583-235628605 CCTTCTTTCCAGAGCATTCAAGG - Intronic
948244944 2:236472966-236472988 CTTCCTTCCCAGGACATGTAGGG + Intronic
1170551074 20:17476880-17476902 CCTGCTTTCCACCAAATGGATGG + Intronic
1170572219 20:17638875-17638897 CCTGCTTTCCCAGCCAAGCAAGG + Intronic
1171091356 20:22288469-22288491 CCTGCTTTCCAGAACAACGATGG + Intergenic
1171296860 20:24024731-24024753 CCTTCTTTCCAGGATGTGAAGGG + Intergenic
1173172609 20:40739717-40739739 CCTGCCTTTCAGGCCAGGCAGGG + Intergenic
1175380298 20:58558130-58558152 CCTCCGTGCCAGGACATGGAGGG - Intergenic
1175565811 20:59975894-59975916 ACTGCTTTCTTGTACATGCATGG - Intronic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1176677961 21:9798699-9798721 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1178496524 21:33090748-33090770 CCTGCCCTGGAGGACATGCAAGG - Intergenic
1179645851 21:42775679-42775701 CCTGAGTGCAAGGACATGCACGG + Intergenic
1179785209 21:43725960-43725982 CGTGCTCTCCAGGCCATGCTGGG + Intronic
1179800842 21:43810890-43810912 CCTGCCCTCTAGGACCTGCATGG + Intergenic
1179993331 21:44959836-44959858 CCTGCTTTCCGGGGCAGGCTGGG + Intronic
1180205353 21:46256195-46256217 CCTGCATTCCTGGCCATGCTGGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183073717 22:35413468-35413490 CTTGCTCCCCAGCACATGCAGGG + Intronic
1183248339 22:36710953-36710975 CCTGGTCACCAGGCCATGCAGGG - Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
950023367 3:9804461-9804483 CCTGTTTTCCATCACTTGCATGG + Intronic
951598615 3:24346229-24346251 ACTACTTTCCAGAAAATGCAAGG - Intronic
954142957 3:48619785-48619807 CCTTCTTCCCAGGCCCTGCAAGG - Intergenic
954263644 3:49457471-49457493 CACACTTTCAAGGACATGCAAGG - Intergenic
955512815 3:59698430-59698452 CCTGCTCTCAAGAACCTGCAGGG + Intergenic
956757797 3:72406338-72406360 ACTGATCTCCAGGACAAGCATGG - Intronic
961538529 3:127585033-127585055 CAAGCTGTCCAGTACATGCACGG - Intronic
963846308 3:150161171-150161193 ACAGCTTTCCAGGACTTGTAGGG + Intergenic
967187867 3:186960852-186960874 CCTGCTGTCCTGGGCCTGCATGG + Intronic
967448816 3:189598742-189598764 CCTGCAGTCCAGGATATGCAAGG + Intergenic
968622829 4:1611372-1611394 GCTGCTCTCCAGGACAGGCCAGG - Intergenic
969551529 4:7871360-7871382 CCAGAATTCCAGGACAGGCAGGG - Intronic
969638818 4:8384771-8384793 CTTGCTTTCCAGGGCTTGCCTGG - Intronic
972492277 4:39599224-39599246 CCTGTTTTCCAGGAACAGCAAGG + Intronic
976497496 4:85747119-85747141 CCTACTTTTCAGGAAATGCCTGG + Intronic
977310042 4:95374574-95374596 CTTGCTTTCCAGGGTCTGCATGG - Intronic
979531067 4:121769647-121769669 CCTCATCTCCAGCACATGCATGG - Intergenic
984212357 4:176866112-176866134 ATTGCTTTCCAGGCCAGGCACGG + Intergenic
986481163 5:8189620-8189642 TCTGCTTTCCAGGCTATGTAGGG - Intergenic
987042220 5:14073579-14073601 CATGCTTTCCAGGAGTTGCAAGG + Intergenic
989193847 5:38696505-38696527 CCTTCTCTCAAGGACAAGCATGG + Intergenic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
997411759 5:133696237-133696259 CCTGGTTTTCAGGGCATGCAGGG + Intergenic
1004087565 6:12465631-12465653 CATGCTTCCCAGCACATGCTCGG + Intergenic
1005804446 6:29461524-29461546 CCTGCTTTCCAGCACATTCTTGG + Exonic
1005819679 6:29587699-29587721 TCTGCTGTCCAGTACATTCATGG + Exonic
1009604097 6:65844781-65844803 GCTAATTTCCAGGAAATGCAGGG - Intergenic
1013138663 6:107308726-107308748 CCTACTCTCCATGCCATGCATGG + Intronic
1014656617 6:124113633-124113655 CCTGCTTCCTTGGAAATGCAAGG + Intronic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1018777838 6:167034609-167034631 CTTGCTTTCCAGAACATGGTGGG + Intronic
1019261763 7:85949-85971 ACAACTTTCCAGGACAGGCAAGG - Intergenic
1019450533 7:1095436-1095458 CCTGCTTTCTGGGACTTGGATGG - Intronic
1020006481 7:4786141-4786163 CCTGCTCTCCAGGACACCAAGGG - Intronic
1022234592 7:28448655-28448677 CTTGCCTTCCAGAACATGTAAGG + Intronic
1022975121 7:35549656-35549678 CTTGCTTTGCAGGGCATGAAGGG - Intergenic
1023378726 7:39584979-39585001 CCTGTAATGCAGGACATGCAAGG - Intronic
1023791415 7:43756718-43756740 TCTGCTCTCAAGGACATGGAGGG + Intergenic
1024026373 7:45413312-45413334 CCAGCTTTCCAGGGGATGCCAGG - Intergenic
1024659005 7:51475557-51475579 GGGGCTTTCCAGGACATTCAGGG - Intergenic
1027485875 7:78761232-78761254 TCTCTTTCCCAGGACATGCAAGG + Intronic
1030667987 7:112302764-112302786 CCTGTTTAACAGGAAATGCAAGG + Intronic
1032468184 7:132159801-132159823 CCTGCTTGCCTGGACAGGAAAGG - Intronic
1033311444 7:140264824-140264846 ACTCCTTTCCAGGCAATGCAGGG + Intergenic
1034001443 7:147417342-147417364 CTTGCTTCCCAGGTCATGGATGG + Intronic
1034904320 7:154930511-154930533 TCTGCTTTCCAGGACTTGGGAGG - Intronic
1035306267 7:157934683-157934705 CCTGCTTCCCAGAGCCTGCAGGG + Intronic
1035465202 7:159070517-159070539 CATTCTATCCAGGACATTCATGG + Intronic
1035523767 8:295928-295950 CGAGCTGTCCAGGAGATGCATGG + Intergenic
1036662559 8:10717346-10717368 CATGCTTTCCATGACTTTCACGG + Intergenic
1041070542 8:54123921-54123943 TCTGTTTTCCAGGACATGGTAGG + Intergenic
1043756668 8:84012108-84012130 CCTGCTTTCTAGGTCATCGATGG - Intergenic
1047795340 8:128249510-128249532 CCTGCCTTCCAGGAGTTTCAGGG + Intergenic
1049540911 8:143208354-143208376 CCTGCCTTCCAGGGACTGCAGGG + Intergenic
1051397270 9:16637420-16637442 CCATCTATCCAGAACATGCAGGG + Intronic
1052562654 9:30106528-30106550 CCTGCTTTCAAGTACGTACAGGG - Intergenic
1057552448 9:96061884-96061906 CCTGCCTTCCAGGATGTGCTTGG + Intergenic
1059520947 9:114941636-114941658 CCTGCTTTTCCAGCCATGCATGG - Intergenic
1061061213 9:128251190-128251212 CCTTCTTTCCAGCACTTGCATGG + Intronic
1203663109 Un_KI270754v1:1191-1213 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1187248496 X:17575279-17575301 ACAGCTTGCCAGGTCATGCAGGG - Intronic
1188022729 X:25176247-25176269 TCCGGTTTCCAGGACAAGCAGGG - Intergenic
1190139456 X:47829601-47829623 ACTGCTATCCAGGCCAGGCATGG + Intergenic
1191681509 X:63845405-63845427 GCAGCTCTCCAGGACATGGATGG - Intergenic
1191690768 X:63935685-63935707 CCTGGCTTCCAGGCCAGGCAGGG + Intergenic
1193486374 X:82089305-82089327 CCCCCTTCACAGGACATGCATGG + Intergenic
1195156231 X:102126438-102126460 CCTGCTTTCACGGACCTGCGGGG - Exonic
1195157882 X:102141699-102141721 CCTGCTTTCACGGACCTGCGGGG + Exonic
1196188077 X:112765622-112765644 CATGATTTCCAGGAAATGAAAGG - Intergenic
1199997061 X:153032124-153032146 CTTGCTCCCCAGGGCATGCATGG + Intergenic
1200457507 Y:3410495-3410517 ACTGCTTTCCACCACACGCAGGG - Intergenic
1202502297 Y:25487550-25487572 CCTTCTGTCCAGTACGTGCATGG + Intergenic