ID: 1152701140

View in Genome Browser
Species Human (GRCh38)
Location 17:81820225-81820247
Sequence GAGCTCCTTGTGTTAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152701140_1152701146 7 Left 1152701140 17:81820225-81820247 CCATCTCTTAACACAAGGAGCTC No data
Right 1152701146 17:81820255-81820277 ACCTCCTGTGTGCTACACAGGGG No data
1152701140_1152701145 6 Left 1152701140 17:81820225-81820247 CCATCTCTTAACACAAGGAGCTC No data
Right 1152701145 17:81820254-81820276 CACCTCCTGTGTGCTACACAGGG No data
1152701140_1152701151 27 Left 1152701140 17:81820225-81820247 CCATCTCTTAACACAAGGAGCTC No data
Right 1152701151 17:81820275-81820297 GGGTCCCAGCACCCATGCAGGGG No data
1152701140_1152701150 26 Left 1152701140 17:81820225-81820247 CCATCTCTTAACACAAGGAGCTC No data
Right 1152701150 17:81820274-81820296 GGGGTCCCAGCACCCATGCAGGG No data
1152701140_1152701149 25 Left 1152701140 17:81820225-81820247 CCATCTCTTAACACAAGGAGCTC No data
Right 1152701149 17:81820273-81820295 AGGGGTCCCAGCACCCATGCAGG No data
1152701140_1152701144 5 Left 1152701140 17:81820225-81820247 CCATCTCTTAACACAAGGAGCTC No data
Right 1152701144 17:81820253-81820275 GCACCTCCTGTGTGCTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152701140 Original CRISPR GAGCTCCTTGTGTTAAGAGA TGG (reversed) Intergenic
No off target data available for this crispr