ID: 1152703067

View in Genome Browser
Species Human (GRCh38)
Location 17:81829041-81829063
Sequence CCTGAGGTGGTGGATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 471}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152703055_1152703067 6 Left 1152703055 17:81829012-81829034 CCTGAGGCACAACATCCATGCAT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG 0: 1
1: 0
2: 2
3: 51
4: 471
1152703060_1152703067 -9 Left 1152703060 17:81829027-81829049 CCATGCATGGGGTCCCTGAGGTG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG 0: 1
1: 0
2: 2
3: 51
4: 471
1152703054_1152703067 7 Left 1152703054 17:81829011-81829033 CCCTGAGGCACAACATCCATGCA 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG 0: 1
1: 0
2: 2
3: 51
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152703067 Original CRISPR CCTGAGGTGGTGGATGTGGA GGG Intronic
900503975 1:3019979-3020001 CCTGAGGCAGTAGGTGTGGACGG - Intergenic
900661026 1:3783784-3783806 CCTGACGTGAGGGAAGTGGAAGG - Intronic
900849058 1:5127724-5127746 CCAGAGGTGCTGGCTGTGGCTGG - Intergenic
900990399 1:6095904-6095926 GCAGAGGTGGGGGATGTGGTAGG - Intronic
901185314 1:7369082-7369104 CCTGTGGTGGGGGAGGAGGAGGG - Intronic
901446278 1:9310049-9310071 CCTCAGGTGGGGGATGGTGAGGG + Intronic
901839481 1:11944883-11944905 CCTGAGGTGGTGGGAGGGGAGGG + Intronic
901842166 1:11960624-11960646 CCTGGGGTTGGGGATGGGGAAGG - Exonic
902206741 1:14873869-14873891 ACTGACGTGGTGGATGTGGTGGG + Intronic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
903541495 1:24098831-24098853 CCTGGGTTGGTTGAGGTGGAGGG + Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904470429 1:30732395-30732417 CCTGGGGTGATGGAGGTAGAAGG + Intergenic
904826945 1:33280207-33280229 CTGGTGGTGGTGGGTGTGGACGG - Exonic
905302609 1:36996083-36996105 CCTGACGTGGAAGAAGTGGATGG - Intronic
905547097 1:38808507-38808529 CCTGAGGCAGAGGAAGTGGAAGG + Intergenic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906481684 1:46203454-46203476 CCTGACCTGCGGGATGTGGAGGG + Exonic
906639212 1:47431659-47431681 CCTTGGGTGGTGGTGGTGGATGG + Intergenic
906827468 1:48996994-48997016 CCTGAGGTGGAGGTTGTAGTGGG - Intronic
907355022 1:53865311-53865333 GCTGAGCCTGTGGATGTGGAGGG - Intronic
908681330 1:66665115-66665137 CGTGGGGTGGTGGATGGGGGAGG - Intronic
908910294 1:69065149-69065171 ACTGAGTTGGTAGATGTGGAGGG + Intergenic
909937977 1:81576147-81576169 CATGAAGTGGTGGATGAGGTGGG + Intronic
911080526 1:93924993-93925015 ACTGAGGGGGTGGATGTGGGAGG + Intergenic
912055477 1:105592925-105592947 ACTGAAGTGGGGGCTGTGGATGG - Intergenic
912799740 1:112713543-112713565 TGTGAAGTGGTGTATGTGGAAGG - Exonic
913002829 1:114598512-114598534 CCTTTGGTGGGGGATGGGGATGG + Intronic
913171161 1:116233598-116233620 CCTATGGTGGTGGCTATGGAGGG + Intergenic
913549819 1:119906645-119906667 CCGAAGGTGGTGGATGGGGCAGG + Intergenic
918427451 1:184425207-184425229 ACTGAGATGGTGTATGTGGAAGG + Intronic
919278720 1:195456743-195456765 CCTGTGGTGGTGGATAGGGCAGG + Intergenic
919300643 1:195759257-195759279 ACTGAGGTGATGGATTTGGCAGG - Intergenic
919408213 1:197210256-197210278 CCTGAGGATGTTGCTGTGGAGGG + Intergenic
919786272 1:201260283-201260305 CCTGAGGGTGTGGCTGAGGACGG + Intergenic
920125466 1:203690886-203690908 CCTGTGGTGGGGGATGGGGAGGG - Intronic
920224675 1:204429913-204429935 CCTGAGGTGGCCGAGGTGGGTGG - Exonic
922427667 1:225514709-225514731 CAGGAGGTGGTGGAGGAGGAGGG + Exonic
922657960 1:227402263-227402285 CCTGTTCTGGTGGAGGTGGAGGG - Intergenic
922792508 1:228317975-228317997 CTTGAGGTGGTGGCTGAGGCTGG + Exonic
923537394 1:234863555-234863577 CCTGTGTTTCTGGATGTGGAAGG - Intergenic
923774137 1:236963267-236963289 CCTGATGTGGTGGTATTGGAGGG - Intergenic
924071529 1:240285250-240285272 CATGATGTGTTGGATGTGGAAGG + Intronic
924134296 1:240947605-240947627 GTGGAGGTGGTGGATGTGGGTGG - Intronic
1063113635 10:3057568-3057590 GCAGAGGAGGAGGATGTGGAAGG + Intergenic
1063213662 10:3904593-3904615 CTTGAGGAGGTGCTTGTGGAAGG + Intergenic
1063688832 10:8264148-8264170 CCTGAGGTCGAGGAGATGGAAGG + Intergenic
1066129750 10:32381354-32381376 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
1068052466 10:51967829-51967851 CCTGAGGTGAGGCATATGGAAGG - Intronic
1068420628 10:56787267-56787289 CTTGAGGTGGCCGGTGTGGAAGG - Intergenic
1068522052 10:58087655-58087677 GCAGAGATGGAGGATGTGGAAGG - Intergenic
1068556486 10:58464712-58464734 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1068744403 10:60513932-60513954 GCTGAGGTGGAGGAAGGGGAAGG - Intronic
1068824483 10:61419163-61419185 CCTCAGGTGGTGGCAGTGGTGGG + Intronic
1069074469 10:64023910-64023932 GCAGAGGTGGTGGAGGTGGAAGG + Intergenic
1069271648 10:66535704-66535726 CCTGTGGTGAGGGATGGGGAGGG + Intronic
1069778780 10:70942002-70942024 ACTGAGGTGGTGCATGAGGCTGG + Intergenic
1070359162 10:75670788-75670810 CCTGAGGTGGGAGGTGTGGCTGG + Intronic
1070493078 10:76995578-76995600 CCTGAGATAGTGGAGGAGGATGG + Intronic
1071062666 10:81591280-81591302 CCTGCTGTGGTGGAGGTGGTAGG - Intergenic
1072207979 10:93221376-93221398 CCTGAGGCTGTGGCTGTCGAGGG - Intergenic
1072686395 10:97539879-97539901 CTTAAGGAGGTGGATCTGGAAGG - Intronic
1072978996 10:100084002-100084024 CCTGAGGTTGGGGATGGGAATGG + Intergenic
1073008235 10:100340708-100340730 ACTGAGGTGGGGGATGTGATGGG - Intergenic
1073048135 10:100652017-100652039 GCAGAGGTGGTGGAGGTGGCGGG - Intergenic
1073153711 10:101329669-101329691 TCTGGGGTGGTGTGTGTGGAGGG - Intergenic
1073700914 10:105925684-105925706 CCTGTGCTGGTGGAGGTGGCAGG - Intergenic
1073723937 10:106208197-106208219 CCAGAGGTTGGGGAGGTGGATGG - Intergenic
1074721936 10:116271872-116271894 GCGGGTGTGGTGGATGTGGAAGG - Intronic
1075731405 10:124638825-124638847 CCGCTGGTGGTGGGTGTGGAAGG + Intronic
1076178767 10:128389376-128389398 GCTGAGGAGGTGGTGGTGGAAGG + Intergenic
1076192409 10:128491928-128491950 CCTGTGCAGGTGGATATGGAGGG + Intergenic
1076379048 10:130012553-130012575 CATGAGGTGGGGGAGGTGGGAGG + Intergenic
1076756996 10:132577685-132577707 CCTGAGGAGATGGATGAGGTGGG + Intronic
1077107574 11:848696-848718 CCAGAGGTGGGGAATGAGGAAGG - Intronic
1077225115 11:1436219-1436241 CCTGCGGTGCTGGATGCGGGTGG + Intronic
1077544277 11:3162403-3162425 CTTGAGGTGGGAGATGGGGAGGG - Intronic
1079348421 11:19672719-19672741 CCTGAGCTGGTTGGTGTGGGAGG - Intronic
1079361036 11:19770486-19770508 ATTGAGGTGGTGGGTGGGGAGGG + Intronic
1080121739 11:28685736-28685758 GCTGAGGAGGAGGATGAGGAGGG + Intergenic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1081198083 11:40185772-40185794 CCTGAGGTCTTGCATGAGGATGG + Intronic
1081731415 11:45374428-45374450 CCAGAAGGGGTGGATGAGGAAGG - Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083618405 11:64037216-64037238 CCTGGGGAGGGGGATGTGGAGGG - Intronic
1083803273 11:65058681-65058703 CAGGATGTGGTGGATGTGGATGG - Intergenic
1083998333 11:66283123-66283145 CCAGAGGTGGTAGAAGAGGAGGG - Exonic
1084530843 11:69726963-69726985 CCTCTGATGGTGGATGTGGCCGG - Intergenic
1085089858 11:73702413-73702435 CTTCAGGAGGTGGATGTGGGAGG - Intronic
1088475439 11:110233392-110233414 CTGGTGGTGGTGGAGGTGGAGGG + Exonic
1089631283 11:119785972-119785994 CCTGGGGTGGGGGATGGGGAAGG + Intergenic
1090080877 11:123611812-123611834 CCTGAGGAGGGGGATGAGGCTGG + Intronic
1090558089 11:127898581-127898603 CCTTGGGTGGTGGATGGGGCCGG + Intergenic
1090753084 11:129764250-129764272 CCTGCTGTGGTGGAGGTGGTGGG - Intergenic
1091369508 11:135046875-135046897 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369523 11:135046926-135046948 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369538 11:135046977-135046999 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369553 11:135047028-135047050 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369568 11:135047079-135047101 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091747837 12:3003908-3003930 GCTGAGGTGGTGGCGGTGGGAGG - Intronic
1092065620 12:5587814-5587836 CCTGAGGAGGTGCATGGGGGTGG - Intronic
1092081496 12:5720142-5720164 GCTGTGGTGGTGGATGGAGAAGG + Intronic
1092204182 12:6605924-6605946 CTTGTGGTGGTGGTGGTGGAGGG - Intronic
1092527385 12:9317498-9317520 CCTGAGGTGGAGGACCTGAAAGG - Intergenic
1092539891 12:9414277-9414299 CCTGAGGTGGAGGACCTGAAAGG + Intergenic
1093926592 12:24914188-24914210 CCTCGGGAGGTGGATGTGGGAGG - Intronic
1094524363 12:31221950-31221972 CCTGAGGTGGAGGACCTGAAAGG - Intergenic
1095212546 12:39510408-39510430 CCAGAGGTGGTAGATGGGGTGGG - Intergenic
1096384756 12:51187799-51187821 TCTGTGGTGGTGGACGTGCAGGG - Exonic
1096574889 12:52546555-52546577 CCAGAGGGATTGGATGTGGATGG - Intronic
1097178273 12:57156248-57156270 CCTCTGGTGGTAGATGTGGAGGG - Exonic
1097721862 12:63030462-63030484 CATGAGGTGGGGGATGGGGGAGG - Intergenic
1098394865 12:70006503-70006525 CCTATGGTGGTGGATGGGGTAGG - Intergenic
1099211809 12:79800264-79800286 TCAGAGGTGGTGGAGGTGGAAGG - Intronic
1101168304 12:102061949-102061971 GCTGAGGAGATGGATGAGGACGG - Exonic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1103281401 12:119760747-119760769 ACTGAGGTGGTGGCTCTGGATGG - Intronic
1104023265 12:125008045-125008067 TCTGAGGCAGTGGATCTGGATGG + Intronic
1104131428 12:125897961-125897983 GCTGAACTGGTGGATGAGGATGG + Intergenic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1104888316 12:132125235-132125257 CCTGTGGTGGTGGGGGTGGTGGG - Intronic
1105974746 13:25463830-25463852 CATGAGGGGGTGGAAGGGGAGGG - Intronic
1105984680 13:25553783-25553805 TCTGAGGTGGTGTCTGTGGAAGG - Exonic
1106361912 13:29038932-29038954 CATGAAGTGGTGGCTTTGGAAGG - Intronic
1108164215 13:47675342-47675364 TATGAGGTGGGGGATGGGGAAGG - Intergenic
1108781129 13:53835525-53835547 GCAGAGGTGGAGGAGGTGGAAGG - Intergenic
1109035048 13:57246906-57246928 ACTGAGGTGATGGATGTGAATGG + Intergenic
1112080078 13:95959601-95959623 CCTGAGGTGATGGTAGTGGCAGG - Intronic
1112780185 13:102891933-102891955 CCTTGGGAGGTGGAGGTGGATGG - Intergenic
1113841195 13:113362811-113362833 CCTGAGAAGGGGGATGTGAATGG - Intronic
1114560782 14:23589041-23589063 CCTGTGGGGGTGGAGGTGGGAGG + Intergenic
1114694266 14:24612107-24612129 CCTGCTCTGGTGGAGGTGGAAGG + Intergenic
1116088950 14:40279102-40279124 CCTGTTCTGGTGGATGTGGCAGG + Intergenic
1118362182 14:65065998-65066020 CCTGCGGTGGTGGAAGGGCATGG - Intronic
1118710899 14:68518574-68518596 CCTGAGGGGATGAAAGTGGATGG - Intronic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1119199998 14:72745082-72745104 CCTCAGGGGGTGGGTGTGGAGGG + Intronic
1119555687 14:75550732-75550754 CCTGTGGGGGTGAATGTGGACGG - Intergenic
1121939100 14:98052312-98052334 TCTGTGGTGATGGATGTTGAAGG + Intergenic
1123416071 15:20096335-20096357 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123525411 15:21103444-21103466 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123992656 15:25695007-25695029 CCAGAGGCAGTGGACGTGGAGGG + Exonic
1124842067 15:33251536-33251558 CCTGAGGTGATGGATGAAGAGGG - Intergenic
1125028729 15:35055651-35055673 CCTGTGGTGGGGGATGGAGATGG - Intergenic
1125050553 15:35293751-35293773 ACAGAGGTGGTGGATGTGAAAGG + Intronic
1125589600 15:40846014-40846036 TCTGGGGTGGGGGATGAGGAGGG + Intronic
1125702219 15:41696973-41696995 CCTGATCTGGAAGATGTGGATGG + Exonic
1126177580 15:45751923-45751945 CTTGGGGTGGGGGATGGGGACGG + Intergenic
1126980488 15:54237322-54237344 CCTGAGGTGGTTGAGGGGGCTGG + Intronic
1127884676 15:63189193-63189215 TCTGAGGTCCTGGATTTGGAAGG + Intergenic
1128173297 15:65531200-65531222 CCGGAGGTGGGGGAGGGGGAGGG + Intronic
1128225990 15:66001674-66001696 CCTGAAGAGGTGGAGGTGGGAGG + Intronic
1128333778 15:66773202-66773224 GCTGAGGTGGGGGGTGGGGAGGG + Intronic
1130758771 15:86795528-86795550 GCTGAGGGGCTGGATGAGGAAGG - Intronic
1131159515 15:90095744-90095766 CCGGAGGCAGTGAATGTGGAAGG + Intronic
1131316672 15:91344919-91344941 CATGAGGTGGGGGAGGTGGGTGG - Intergenic
1131374457 15:91912171-91912193 CCTGAGGAAGAGCATGTGGAAGG - Intronic
1131379625 15:91953408-91953430 CCAGAGGTGGTGAATGCGGTGGG + Intronic
1131379728 15:91953886-91953908 TCTGAGGTGGAGGATGGGAATGG + Intronic
1133030469 16:3008450-3008472 CCAGACGTGGTGGATGGGGGAGG + Intergenic
1134562013 16:15219040-15219062 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1134922551 16:18130666-18130688 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1136006499 16:27333860-27333882 CCTGAAGTGGTGGAGTTGGAAGG - Intronic
1138157937 16:54722991-54723013 CTGGAGGTGGAGGATGAGGATGG + Intergenic
1138288912 16:55830908-55830930 CCAGAGGTGGGGGAAATGGAAGG + Intronic
1138392496 16:56680717-56680739 ACTGAGGTGGTGCATTTGGGAGG + Intronic
1138589046 16:57989722-57989744 CCAGAGGCGGGGGATGGGGATGG - Intergenic
1138889539 16:61125926-61125948 ACTGTGGTGTAGGATGTGGATGG - Intergenic
1138960539 16:62023701-62023723 CCTATGGTGGAGGATGAGGATGG + Intronic
1139533719 16:67558442-67558464 CCTGAGGCAGTGGATTTAGAGGG - Intergenic
1140044124 16:71429173-71429195 CTTGAGCTGGTAGAAGTGGAAGG + Intergenic
1141068658 16:80933919-80933941 CTGGAGGTGGTGGGTCTGGAGGG - Intergenic
1141300652 16:82812484-82812506 GGTGAGGTGGTGGAGGTGCAGGG + Intronic
1141638505 16:85328343-85328365 TCTGAGGAGGTGGCTGGGGAAGG - Intergenic
1141755123 16:85985905-85985927 CACGAGGTGGTCGGTGTGGAGGG + Intergenic
1141797531 16:86285366-86285388 CCAGAGGTGGGGGATGGGAAGGG - Intergenic
1142351657 16:89583483-89583505 CGTGAGGTGGTGGACGTGCAGGG + Exonic
1142608731 17:1096533-1096555 TCTGAGGCTGTGGCTGTGGAGGG + Intronic
1143015767 17:3890416-3890438 CCTGGTGTGGAGGATGAGGAGGG - Intronic
1143176834 17:4960295-4960317 CATGATGTGGTGGAAGTGGCTGG - Exonic
1143254192 17:5543683-5543705 CCTGAGGAAGTGGAGGTGGCTGG + Intronic
1143335222 17:6167080-6167102 CCTGGGATGGTGGCAGTGGATGG + Intergenic
1143514383 17:7412072-7412094 GGGGAGGTGGTGGATGGGGAGGG - Intronic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1144669850 17:17126744-17126766 ACAGATGTGGTGGATGGGGAGGG + Exonic
1144772946 17:17769894-17769916 CCTCAGGAGGTGGTTGTGGGAGG + Intronic
1145104781 17:20105857-20105879 TCTGGGGTGGTGGCTGGGGATGG + Intronic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146721263 17:35125328-35125350 ACTCAGGAGGTGGAGGTGGACGG + Intronic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147532304 17:41290854-41290876 CCTGGGGAGGGGGATGTGGATGG + Intergenic
1147742172 17:42675792-42675814 CCTGAGGGGATGGATGGTGAGGG - Intronic
1147891402 17:43720031-43720053 ACCGAAGTGGTGGCTGTGGAGGG + Intergenic
1148035511 17:44656677-44656699 CTTGAGGTAATGGATGAGGAAGG + Exonic
1148126951 17:45242025-45242047 CCGGAGGTGGTGGCGGTGGCGGG - Exonic
1148478660 17:47945852-47945874 CCTGAGCAGGTGCGTGTGGAAGG + Exonic
1148479339 17:47949852-47949874 CCTGAGGTGGGGGATAAGGATGG - Intergenic
1148798154 17:50207338-50207360 CCTGGGGTGGGGGTTGTGGGGGG - Intergenic
1148848686 17:50543567-50543589 CCTGAGGTGGGGGTAGGGGAAGG + Exonic
1149301980 17:55313776-55313798 CCTGAGGTGCTGGCAGAGGATGG - Intronic
1149852754 17:60050200-60050222 CCTCAGGTGGTGGAAGGGGCAGG - Intronic
1150315043 17:64161962-64161984 TCTGAGGTGGTGGCCGTGTAGGG - Intronic
1150497271 17:65617536-65617558 CCTGAGTTGGTGAATGAGAAAGG + Intronic
1150681213 17:67286013-67286035 CCTGAGGTGGTGTATGAGTTAGG + Intergenic
1151293337 17:73165798-73165820 CCCGAGGTGGGGGACGGGGACGG - Intronic
1152660071 17:81537952-81537974 CCCCAGGCTGTGGATGTGGACGG - Intergenic
1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG + Intronic
1152774407 17:82191532-82191554 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
1152888288 17:82865374-82865396 CACGATGGGGTGGATGTGGAGGG - Intronic
1154297931 18:13166281-13166303 CCTGCTGTGGTGGAGGTGGCAGG - Intergenic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1154490876 18:14921236-14921258 CCTGTTGTGGTGGGTGTAGAGGG + Intergenic
1155224586 18:23718323-23718345 CATGAGGAGGTGGGTGCGGAGGG + Intronic
1156384409 18:36592750-36592772 CCTAAGGTGGGGGCTTTGGAGGG + Intronic
1156424791 18:36998186-36998208 CCTAAGGTGGTGGATTGGGTTGG - Intronic
1156476670 18:37409908-37409930 CCTGAGGCGCTGCATGTGAAGGG - Intronic
1157685748 18:49640997-49641019 CCTGGGGAGGTGGGTGTGGCTGG + Intergenic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1158737838 18:60104039-60104061 CCTGAGGAAGTGGATGGGGTGGG + Intergenic
1160014093 18:75127624-75127646 CCTAGGTTGGTGGCTGTGGACGG - Intergenic
1160210631 18:76875102-76875124 CCTGGGGTGGTGGTTGTGGACGG + Intronic
1160388478 18:78512488-78512510 CCAGCGGTGGTGAATGTGGCTGG - Intergenic
1160434418 18:78834951-78834973 CCTCCGGGGGTGGCTGTGGATGG - Intergenic
1160735643 19:661266-661288 CCTGGAGTGGTGGCTGTGGGGGG - Intronic
1160773885 19:846049-846071 TTTGAGGTGGTGGGTGTGGTGGG + Intronic
1160962491 19:1729774-1729796 CCTGAGGAAGTGGCTGTGGACGG - Intergenic
1161701928 19:5800486-5800508 CCTGTGGGGGTGGAGGTGGCTGG - Intergenic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162714024 19:12617838-12617860 GCTGAGGTGGTGGTTGTAGTAGG - Intronic
1163290814 19:16377917-16377939 TGTGGGGTGGAGGATGTGGATGG - Intronic
1164521406 19:28982811-28982833 CCGGAGGTGGAGGCTGTGGTGGG + Intergenic
1164738263 19:30558388-30558410 GCTGGGGTGGTGGGGGTGGAGGG + Intronic
1165132036 19:33638896-33638918 CTTGAGGGAGAGGATGTGGATGG + Intronic
1165879262 19:39031456-39031478 CCTGAGCTGGTGGGAGGGGAAGG - Intronic
1165995458 19:39840561-39840583 CCTGAGGTGGGGAGTGGGGAGGG - Intronic
1166455729 19:42938267-42938289 CCTGAGATGGTGGGTGGGGGTGG + Intronic
1167521638 19:49959151-49959173 ACTGAGGTGGGGGAAGTGGGTGG + Intronic
1167523743 19:49971571-49971593 ACTGAGGTGGGGGAAGTGGGTGG - Intergenic
1167756321 19:51415689-51415711 ACTGAGGTGGGGGAAGTGGGTGG + Intronic
1168246433 19:55114977-55114999 CATGAGATGGTGGACGAGGAAGG + Intronic
925644006 2:6017466-6017488 CCGGAGGAGGTGGAAATGGATGG - Intergenic
927692732 2:25219652-25219674 CCTGGGGTGGTGGGTGGAGAAGG + Intergenic
928148376 2:28804052-28804074 CCTGAGAAGGAGGATGTGCAGGG + Intronic
928198064 2:29229050-29229072 CCGCAGGTGGTGGAGGTGGCTGG - Exonic
929673715 2:43903226-43903248 CCTGGGGGGAGGGATGTGGATGG - Intronic
929741732 2:44609189-44609211 ACTGGGGTGGTTAATGTGGAGGG + Intronic
931263128 2:60637626-60637648 CCTGAGGTGGTGGTGTTGGGAGG - Intergenic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
932688401 2:73892634-73892656 CCTGAGGAGGGAGGTGTGGACGG + Intronic
932742304 2:74301049-74301071 CCTGACGTGTTAGATGTGAATGG - Intronic
933036215 2:77402252-77402274 CCTCAGGAGGCTGATGTGGAAGG - Intronic
933105919 2:78325081-78325103 ACTCAGGAGGTGGAGGTGGAAGG - Intergenic
933736035 2:85495146-85495168 GCTTAGGTGGGGGATGGGGAAGG - Intergenic
934079901 2:88458846-88458868 CCTGAGGTGGGAGGAGTGGAGGG - Intergenic
934161099 2:89250435-89250457 CCTCACGTTGTGGAGGTGGAAGG - Intergenic
934206178 2:89931998-89932020 CCTCACGTTGTGGAGGTGGAAGG + Intergenic
934654812 2:96111980-96112002 CCTGATGTGGGTGATGAGGATGG - Intergenic
935078815 2:99772078-99772100 TCTGAGGTGGAGGATGGGAAAGG - Intronic
936096412 2:109533514-109533536 CCTGAGGAGGAGGCTGCGGATGG + Intergenic
937004365 2:118497616-118497638 ACTGAGATGGTGGTGGTGGATGG - Intergenic
937077660 2:119118552-119118574 CCTGAAATGGTGGATGGGGTGGG + Intergenic
937344110 2:121112823-121112845 CCTGAGCTGGGGGATGGGGCAGG - Intergenic
937854008 2:126659862-126659884 CAGGAGGTGGAGGAGGTGGAGGG - Intronic
938741863 2:134239692-134239714 CCTGGGGATGAGGATGTGGATGG + Intronic
938972011 2:136441604-136441626 CCTGATCTGGTGGCTTTGGAGGG - Intergenic
939099485 2:137879949-137879971 CTTGAGGTGGTGGGGGAGGAGGG - Intergenic
939941655 2:148358698-148358720 CTTGAGGTGGGGGTTGGGGATGG + Intronic
943220759 2:185102570-185102592 CTTTAGGAGGTGGAGGTGGATGG + Intergenic
943591235 2:189799661-189799683 CCTGAAGTGGGGGATCTAGATGG - Intronic
947035625 2:225851127-225851149 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
947118590 2:226796233-226796255 CCTGATGGTGGGGATGTGGAAGG + Exonic
947318671 2:228893298-228893320 CCTGAGGTGGTAGACTTGAAAGG - Intronic
947441630 2:230127046-230127068 CCTGAGCCCATGGATGTGGATGG + Intergenic
947632620 2:231663756-231663778 CCTCTGGTGGTGGAAATGGAGGG + Intergenic
948421654 2:237863960-237863982 CCTGGGGTGGTGGGTGGGGTGGG - Intronic
948823815 2:240564672-240564694 CCTGATGTCCTGGCTGTGGAGGG + Intronic
948891698 2:240909953-240909975 CCAGGGGTGGTGGCTCTGGACGG + Intergenic
949081138 2:242100596-242100618 AAGGAGGTGGTGGATGAGGAAGG + Intergenic
1170123520 20:12936391-12936413 CCTGGGGATGTGGATATGGATGG + Intergenic
1170780283 20:19419613-19419635 CCTGAGGGGAGGGATGTGAAGGG + Intronic
1171060785 20:21957128-21957150 TCCTAGGTGGTGGCTGTGGAGGG + Intergenic
1172284979 20:33733918-33733940 CAGGAGGTGGTGGATCAGGAAGG + Intronic
1172754383 20:37273082-37273104 CCTGGAGTGGTGGTTTTGGAAGG + Intergenic
1173322543 20:42001337-42001359 CCCGAGGTGGTGGATTAGGTTGG + Intergenic
1174262887 20:49309903-49309925 TCTGAGGAGGTGGCTGAGGAAGG - Intergenic
1174459519 20:50672777-50672799 CCTGGGGTGGTGGGTGGGGAAGG - Intronic
1175237617 20:57525309-57525331 CCTGGGGGGGTGGATGAGGAGGG + Intronic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175681775 20:60994644-60994666 CCTGAGGTAGAGGAGGTGGGAGG - Intergenic
1175806130 20:61830315-61830337 TCTGAGGCAGAGGATGTGGATGG - Intronic
1175948784 20:62571567-62571589 CCTGAGGTGGGGGAGGGGGATGG + Intergenic
1176053502 20:63133166-63133188 CCTGAGCTGGTGGAACTGGCCGG + Intergenic
1176059756 20:63167483-63167505 GCTGAGGTGGGGGCTGAGGAGGG - Intergenic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1178446496 21:32648219-32648241 CCTAGGGTGGTGGTTTTGGATGG - Intronic
1178676945 21:34639071-34639093 CAGGAGCTGGTGGATGGGGATGG + Intergenic
1178876949 21:36420967-36420989 TGAGAGGTGGTGGTTGTGGAGGG + Intergenic
1179712439 21:43271148-43271170 CCTGCGGAGGAGGATGTGGAGGG + Intergenic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1179984762 21:44914136-44914158 CCAGAGCTGGAGGATGAGGAGGG - Intronic
1181415176 22:22754125-22754147 CCAGGGACGGTGGATGTGGAGGG - Intronic
1181435871 22:22910497-22910519 CTTCAGGTGGGGGATGGGGAGGG + Intergenic
1182493709 22:30691966-30691988 CCAGAGGTTTTGCATGTGGATGG - Intergenic
1182543619 22:31059665-31059687 CCTGAGAAGGAGGATCTGGATGG + Intergenic
1183074955 22:35421017-35421039 CCTCAGGTGGCTGAGGTGGAAGG + Intronic
1183227964 22:36563324-36563346 CCTGAGGTGAGGGGTGAGGAGGG + Intergenic
1183256718 22:36767125-36767147 ACTGAGGAGGTGGAGGAGGAAGG - Intronic
1183345801 22:37307046-37307068 ACTGAGGAGGTGGGGGTGGAGGG + Intronic
1183463466 22:37967109-37967131 CCTGTGATGGTGGAGCTGGAGGG + Exonic
1183473224 22:38020802-38020824 CGAGAGGGGGTGGAGGTGGAGGG - Intronic
1183728870 22:39605830-39605852 CCTGAGGGGGTGCATGAGGAAGG + Intronic
1184273500 22:43397883-43397905 CCTGAGGTTGTTGGTGTGCAGGG + Intergenic
1184507819 22:44914693-44914715 CCTCACGTGGTGGATGGGGAAGG + Intronic
1185290781 22:50026287-50026309 TCTGAGGTGGCGGCTGTGCAGGG - Intronic
950319979 3:12042626-12042648 CCTGAATTGGGGGATGGGGAGGG - Intronic
950389738 3:12687114-12687136 CATGGGGAGGTGGAGGTGGAAGG + Intergenic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
951847229 3:27097556-27097578 ACTGAGGTGATGGAAGAGGAAGG + Intergenic
951961337 3:28325391-28325413 CCTGGGAGGGTGGATATGGATGG + Intronic
952387247 3:32850924-32850946 CCTGAGGTGCAGGTTGGGGAGGG + Intronic
952769964 3:36990662-36990684 ACTGAGGTGGGTGATGGGGAGGG + Exonic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
952883217 3:37998200-37998222 GCTGGGGTTGTGGATGGGGAAGG - Intronic
953195720 3:40731407-40731429 CCTGAGCAGGTGGAAGTGGTAGG + Intergenic
953627179 3:44580695-44580717 ACAGATGTGGTGGATGGGGAGGG - Intronic
955266457 3:57449567-57449589 CCTGGGCTAGTGGCTGTGGAGGG - Intronic
955338481 3:58106659-58106681 CCCTAGGGGGTGGAGGTGGAAGG - Exonic
955598974 3:60623884-60623906 CCTGAAGTGGGGGGTATGGAGGG - Intronic
955961234 3:64343248-64343270 CCTGGGGTGGTGGAGGGGCAGGG - Intronic
955984581 3:64559398-64559420 ACTGGGGTGGTGAAAGTGGACGG - Intronic
956012762 3:64849263-64849285 CGGGAGGTGGAGGTTGTGGAAGG - Intergenic
956826006 3:72997196-72997218 CCTGGGGAGGTGGAGGGGGATGG - Intronic
956879873 3:73499679-73499701 CCTGAGGTGGTGGTGGTGGTTGG + Intronic
956900714 3:73713241-73713263 CATGAGCTAGTGGAGGTGGAAGG + Intergenic
957721973 3:84013599-84013621 CCTGGGGTCGGGGATGGGGAAGG + Intergenic
958135196 3:89479527-89479549 ACGGAAGTGGTGGCTGTGGAAGG + Exonic
959190327 3:103103229-103103251 CCAGTGATGGTGGATGTGGCTGG + Intergenic
959827332 3:110814150-110814172 CTAGAAGTTGTGGATGTGGAAGG - Intergenic
960829849 3:121834935-121834957 TCTGAGGTGGTGGCTGGGGAGGG - Intronic
960987864 3:123292283-123292305 CCTGTGGTGGTGGATGTCCATGG + Intronic
961386643 3:126526664-126526686 GCTGAGGCTGTGGCTGTGGAGGG - Intronic
961516986 3:127444128-127444150 CCTGAGGTGGTTCATGTGAGTGG + Intergenic
964409152 3:156380134-156380156 CCTCAGCTGATGGATGGGGAGGG - Intronic
964490110 3:157227258-157227280 CCTGAGCAGCTGAATGTGGAGGG + Intergenic
967078108 3:186023532-186023554 CCTGAGAAGGTGGAAGTGGGTGG + Intergenic
967653348 3:192014496-192014518 CCTCAGGAGGTGGAGGTGGGAGG - Intergenic
967867601 3:194203461-194203483 TCTGAGGTGGTGGTTGTCGAAGG + Intergenic
967999189 3:195191239-195191261 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
968663569 4:1809086-1809108 CCTGAGGTGGTGGTGGTGGTGGG + Intergenic
968943973 4:3654025-3654047 CCTGAGCGGGCGGAGGTGGAGGG + Intergenic
969599847 4:8169872-8169894 CCTGAGATGGGGTGTGTGGAAGG - Intergenic
970477941 4:16443074-16443096 TCTCAGGTGTTTGATGTGGAAGG - Intergenic
970529630 4:16968597-16968619 CATGTGGTGGTGGATGGGGTGGG - Intergenic
970909576 4:21258975-21258997 ACTGGGATGCTGGATGTGGATGG + Intronic
971648496 4:29239579-29239601 ACTGAGAAGGTGGAAGTGGAAGG - Intergenic
972092906 4:35310858-35310880 CCTGAGTTGGTGGAGGTAGATGG + Intergenic
973037447 4:45423821-45423843 CCTGCTGTGGTGGAGGTGGCAGG + Intergenic
973542424 4:51947645-51947667 CATGGGGTGGTGGATGGGGGAGG - Intergenic
973588719 4:52418858-52418880 TCTGAGGTAGTGGAGGTGGTGGG - Intergenic
974086179 4:57263831-57263853 CCAGAGGTGGAGGATGTGTGTGG - Intergenic
975900104 4:79141339-79141361 CCTGAGGTGGGTGCTGTGGATGG + Intergenic
975900136 4:79141446-79141468 CCTGGGGTGGAGGTTGTGGTGGG + Intergenic
977273533 4:94947824-94947846 CCAGAGGTGGTGCAGGTGGGAGG - Intronic
978291779 4:107150534-107150556 GCAGAGGTGGGGGATGGGGAGGG + Intronic
978852226 4:113352930-113352952 CCTGTGGTGGTGGTGGTGGGAGG - Intronic
981255882 4:142660182-142660204 CATGAAGTGGGGGATGGGGAGGG - Intronic
982267891 4:153556687-153556709 CCTGTGGAGGTGGAAGAGGAGGG + Intronic
982797712 4:159665212-159665234 AGTGAGGTGGTGGGTGGGGAGGG + Intergenic
983933779 4:173481578-173481600 GAAGAGGTGGAGGATGTGGAGGG - Intergenic
984776347 4:183484235-183484257 CATGAGGTTAGGGATGTGGATGG + Intergenic
985665683 5:1180604-1180626 CCTGAGGCGGGGGATGGGGGTGG + Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
985752392 5:1688059-1688081 CCTGAGGACGTGGGTGTGCAGGG - Intergenic
986019778 5:3790391-3790413 ACAGAGGTGGTGGTAGTGGAGGG + Intergenic
986260965 5:6146000-6146022 CCTGGGGAGGTGGACGTGGATGG - Intergenic
986763167 5:10898385-10898407 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
987465557 5:18268009-18268031 CCTAAGTTGGGGGGTGTGGAAGG - Intergenic
987859229 5:23462826-23462848 CCTGAGGTGGTCTATGAAGATGG + Intergenic
989383944 5:40836099-40836121 ACTCAGGGGGTGGAGGTGGAGGG + Intergenic
989743437 5:44799047-44799069 ACTGAGGTGGGGGTTGCGGATGG - Intergenic
990400230 5:55430081-55430103 CCATAGGTGGTGCATGTGGGTGG - Intronic
990741594 5:58918164-58918186 ACTGAGATGTTGGATGTGAAAGG + Intergenic
991389360 5:66125724-66125746 ACTGAGGTGGTGAAGGTGCAGGG + Intergenic
991406870 5:66308687-66308709 AGTGAGGTGGTAGATGTGAAAGG - Intergenic
992015034 5:72566997-72567019 CCAGAGGTGGTGGTGGTGGTGGG + Intergenic
994224914 5:97240547-97240569 CCTGAGGTGATGGATATGATTGG + Intergenic
995565058 5:113425849-113425871 CTGGGGGTGGTGGAAGTGGATGG + Intronic
995616754 5:113973036-113973058 GCTGTGGTGGTAGAAGTGGAAGG - Intergenic
996542027 5:124640404-124640426 CATGAGCTGGTGGGTGGGGAAGG - Intronic
996921035 5:128767971-128767993 CCTGAGGTGGAGAATATGGTGGG + Intronic
997241710 5:132312591-132312613 CCTGAGGTGGTGGTGGAGCAGGG - Intronic
997836158 5:137195007-137195029 ACTCACGTGTTGGATGTGGAGGG - Intronic
998618460 5:143767754-143767776 CCTGATTTAGAGGATGTGGATGG + Intergenic
999053688 5:148550954-148550976 CCTGAGCTGGGGGCTGTGGCAGG - Intronic
999682771 5:154075395-154075417 TCTGACGTGGAGGATGGGGAAGG - Intronic
1001160755 5:169310779-169310801 CATGGGGTGGGGGATGGGGAAGG - Intergenic
1001398603 5:171433556-171433578 CCTGAGCAGCAGGATGTGGAAGG + Intronic
1002888204 6:1313543-1313565 CCTGAGGCGGCGGCTGCGGAAGG - Exonic
1003259999 6:4508487-4508509 ACTGAGCTAGTGTATGTGGAGGG - Intergenic
1003291806 6:4786142-4786164 CCTAAGGAGGTGGAGGTGGGAGG + Intronic
1004406465 6:15337983-15338005 CGTGAGGTGGAGGATTTGGTTGG - Intronic
1005913571 6:30331679-30331701 CCTATGGTGGAGGATGGGGAGGG - Intronic
1005959133 6:30683952-30683974 CCTGGGGTGGTGGAGGGGGTGGG - Intronic
1006000925 6:30964538-30964560 CCTGAGGTGGAAGCTGTGGTGGG - Intergenic
1006342347 6:33453481-33453503 CTTGAGGTGGTGGGTGGGGAGGG - Exonic
1006396468 6:33790460-33790482 CCTGAGGTGGAGCAAGTGGCAGG - Intergenic
1006453285 6:34117686-34117708 GGTGAGGAGGTGGATGTGGCAGG - Intronic
1006620240 6:35358896-35358918 ACTGAGGTGGGGGAAGTGGAGGG + Intronic
1006904164 6:37521768-37521790 CCTGGTGTGGTGGGTGGGGAAGG + Intergenic
1006984072 6:38166271-38166293 CCGGTGGTGGGGGAGGTGGAGGG - Intergenic
1006984083 6:38166304-38166326 CCGGTGGTGGGGGAGGTGGAGGG - Intergenic
1006984165 6:38166578-38166600 CCGGTGGTGGGGGAGGTGGAGGG - Intergenic
1007078520 6:39083021-39083043 CCATAGGTGGTGCATGAGGAGGG - Intronic
1007255693 6:40526745-40526767 AATGAGGTGGTGGGTGTGCAGGG - Intronic
1008468601 6:51858018-51858040 CCTGAAGGGGTGGGTGGGGAAGG - Intronic
1011788084 6:90868491-90868513 CCTGACTTAGTGGATGTGGAAGG + Intergenic
1012562187 6:100596900-100596922 GATGAGGTTGGGGATGTGGAGGG - Intronic
1012594516 6:101023957-101023979 CCCTAGGTGGTGTATGTGGGTGG - Intergenic
1013136932 6:107291454-107291476 ACTGAGGAGGTTGAAGTGGAAGG - Intronic
1013551638 6:111213279-111213301 CCTGAGGAGGTGAATGGGCATGG + Intronic
1014009383 6:116458868-116458890 CCAGTGGTGGTGGGAGTGGATGG + Intergenic
1014155515 6:118104841-118104863 CCTGAGGGGCTGGACTTGGAGGG - Intronic
1014527582 6:122519444-122519466 ACGGAGGTGGGGGATGTGGGGGG - Intronic
1016551185 6:145281854-145281876 CTTTGGGAGGTGGATGTGGACGG - Intergenic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1018186027 6:161265685-161265707 CCTTAGCTGGTGGGTGGGGAGGG + Intronic
1018967076 6:168497457-168497479 CATGTGGTGGTGAATGCGGATGG + Intronic
1020263918 7:6547781-6547803 CCTGAGGGGGTTAATTTGGAAGG + Intronic
1020489003 7:8756024-8756046 CCAGATGTGATGGCTGTGGAAGG + Intergenic
1021364495 7:19760099-19760121 CCTGAGGGGGAGGAGGTAGAAGG - Intronic
1021580036 7:22142767-22142789 ACAGAGGTGGGGGATGGGGATGG + Intronic
1022562025 7:31359286-31359308 GCTGAGGTGGGTGATGTGGGTGG + Intergenic
1024065292 7:45727196-45727218 CCTGAGATGATGGTTGAGGAAGG - Intergenic
1024514275 7:50231584-50231606 CGTGGGGTGGGGGATGGGGAAGG - Intergenic
1024859262 7:53818688-53818710 GAAGAGGTGGTAGATGTGGAAGG - Intergenic
1026321328 7:69269906-69269928 CCGGAGGAGGTGGAGGTGGAGGG + Intergenic
1026508928 7:71011211-71011233 CCAGAGGTGTTGGCTGGGGAAGG - Intergenic
1026911663 7:74094822-74094844 CCGGAGGTGGTGGCGGTGGCAGG - Intronic
1026976445 7:74501607-74501629 TCTAAGGTGGTGGATGGGGGAGG + Intronic
1027641538 7:80739636-80739658 AGTGAGTTGGTGGAGGTGGATGG + Intergenic
1029021022 7:97364735-97364757 CCTCAGGTGGTGCATTTGGGGGG - Intergenic
1029347938 7:99992411-99992433 CCTGAGGTGGTGGCTGCTGGCGG + Intergenic
1029510722 7:100993246-100993268 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029511213 7:100996495-100996517 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029511439 7:100997917-100997939 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029511941 7:101001166-101001188 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029512495 7:101004907-101004929 CCTGAGGTGGTGGTGCTGGCAGG - Exonic
1029709198 7:102290336-102290358 CCAGAGGTGGTGGAGGTTGCAGG - Intronic
1030352085 7:108500955-108500977 CCTCAGATGGTGGCAGTGGAAGG - Intronic
1030562609 7:111109614-111109636 CATGAGGTGGTGAAAGTTGAAGG - Intronic
1030741261 7:113112814-113112836 TCTAAGGTAGTGTATGTGGAAGG - Intergenic
1032238544 7:130143760-130143782 CCTCACCTGGTCGATGTGGAAGG - Intergenic
1033314004 7:140283083-140283105 CCTGACTTTGTGGATTTGGATGG - Intergenic
1033462702 7:141562047-141562069 CCTGCTGTGGTGGAGGTGGCAGG + Intronic
1033568308 7:142601483-142601505 CCTGAGGTTGTGGGTGTTGCTGG + Intergenic
1034391063 7:150788094-150788116 CCTGAGGAGTCAGATGTGGAGGG + Intergenic
1034531901 7:151701085-151701107 CCTGAGGAGTGGGAGGTGGAAGG - Intronic
1035446367 7:158945664-158945686 CTTCAGGTGCTGGATGTCGATGG - Exonic
1035559500 8:593975-593997 CCTGAGGGGAGGGATGTGAAGGG + Intergenic
1035579772 8:732149-732171 CCTGAGGGGGTGGAGCGGGAGGG - Intronic
1035826379 8:2648481-2648503 CTTTAGGAGGTGGAAGTGGATGG - Intergenic
1036075976 8:5500356-5500378 CCTTAGTTGTTTGATGTGGACGG - Intergenic
1036568665 8:9960362-9960384 CCTCAAGTGCTGGATGGGGAAGG + Intergenic
1037096592 8:14993682-14993704 CCTGAGGTAGAGATTGTGGATGG + Intronic
1039539080 8:38347763-38347785 GAGGAGGTGGTGGCTGTGGAGGG + Exonic
1042225196 8:66509824-66509846 CCTCTGGTGGGGGATGTTGATGG - Intronic
1042281919 8:67064545-67064567 CCTGGGGTGGTGTAGGTTGAGGG + Intronic
1043650034 8:82579348-82579370 CCAGAGGTGGTGCATGTGGATGG - Intergenic
1044719352 8:95130881-95130903 CCTCAGGAGGCTGATGTGGAAGG - Intergenic
1046828394 8:118717153-118717175 GATGATGTGATGGATGTGGATGG + Intergenic
1047334103 8:123919808-123919830 CCTTAGGTGATTGATGTGGAGGG - Intronic
1047416783 8:124671139-124671161 CCTGTCATGGTGGATGTGGAAGG - Intronic
1048525141 8:135195778-135195800 TCACAGATGGTGGATGTGGACGG - Intergenic
1049462938 8:142738514-142738536 CCTGGGGTGGTGGCTGTGCATGG + Intergenic
1049514129 8:143044536-143044558 CCTGAGGTGGGGGGTGGGGTGGG - Intronic
1049579382 8:143404503-143404525 ACTGAGGTGGGGGATGGGCATGG - Intergenic
1050382022 9:5041247-5041269 CCCGAGGTCGATGATGTGGATGG - Intronic
1051685768 9:19656902-19656924 CCTGAGGAGGTGGGAGGGGAGGG - Intronic
1052205255 9:25831143-25831165 CAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1052568655 9:30191324-30191346 ACTGAGGTGGTAAATGGGGAAGG - Intergenic
1052978428 9:34429407-34429429 CCTGAGCTGGTGAGTGAGGAGGG - Intronic
1053413440 9:37930400-37930422 GCTGGGGTGGGGGATGTGGCAGG + Intronic
1053434277 9:38065251-38065273 CCTGATGGGGTGGAGGTGGAGGG + Intronic
1053731811 9:41064687-41064709 GCTGAGGTGGCGACTGTGGAAGG - Intergenic
1055681565 9:78721048-78721070 GCTGAGGAGGAGGATGGGGAGGG + Intergenic
1057705507 9:97392361-97392383 TCTGGAGGGGTGGATGTGGAAGG + Intergenic
1059324123 9:113493264-113493286 GCTGGGGAGGTGGATGTGGAAGG + Intronic
1061053993 9:128212156-128212178 CCTGAGATCCTGGCTGTGGAAGG - Intronic
1061218256 9:129234553-129234575 GCACAGGTGGAGGATGTGGACGG - Intergenic
1062261489 9:135665299-135665321 CCTGAAGTTCTGGAGGTGGAAGG - Exonic
1203768019 EBV:36497-36519 GCTGAGGTGGTGGGGGTGGTGGG - Intergenic
1186128185 X:6438482-6438504 CCTAAGGTTGTGGGGGTGGATGG + Intergenic
1187718449 X:22127724-22127746 CCTGAGGTGGGGGATGGTGTGGG + Intronic
1188616704 X:32166209-32166231 CCTTAGGAGGTAGATGTGGGTGG + Intronic
1189891040 X:45602923-45602945 CCTGGGGTTGTGGGTGGGGAAGG + Intergenic
1190179261 X:48177614-48177636 CGTGAGGTGGTGGGTGTGCTGGG + Intergenic
1190190711 X:48274644-48274666 CATGAGGTGGTGGGTGTGCTGGG + Intronic
1190259050 X:48786624-48786646 CCTGGGCTGGTGGTTGCGGAGGG - Exonic
1190664848 X:52687249-52687271 CATGAGGTGGTGGGTGTGCTGGG + Intronic
1190674574 X:52771170-52771192 CATGAGGTGGTGGGTGTGCTGGG - Intronic
1191121869 X:56914692-56914714 CATGAGGTGGGGGCTGTGGGAGG - Intergenic
1192199984 X:69060590-69060612 CCTAGGGTGGTGGATTTGGCAGG + Intergenic
1192573044 X:72222005-72222027 CCTGGGGTGGAGGGTTTGGAAGG - Intronic
1193404304 X:81082918-81082940 CCTGCTCTGGTGGAAGTGGAAGG - Intergenic
1194439014 X:93906315-93906337 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1197316968 X:124978938-124978960 CCTGAGGTTGTGGTTGTGACTGG - Intergenic
1197760420 X:130024216-130024238 CCTGGGGTGGTGGGGGAGGAGGG + Intronic
1198143088 X:133825576-133825598 CCTGAGGTGGTGGATACAGCTGG + Intronic
1198455990 X:136818303-136818325 GCTGAGGTGGAAGAGGTGGAAGG + Intergenic
1198764013 X:140062695-140062717 CCTGAGGTGCTTGAGGGGGAGGG + Intergenic
1199547221 X:149019011-149019033 CCAGAGGTGGAGGTTGTGGCAGG - Intergenic
1200304397 X:155009283-155009305 GATGAGTTGGTGAATGTGGAAGG - Intronic
1201438648 Y:13985645-13985667 GCAGAGGTGGTGGGTGGGGAGGG - Intergenic
1201445925 Y:14057063-14057085 GCAGAGGTGGTGGGTGGGGAGGG + Intergenic