ID: 1152703741

View in Genome Browser
Species Human (GRCh38)
Location 17:81832693-81832715
Sequence CCTTCTAGGCACTCACTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152703741_1152703749 6 Left 1152703741 17:81832693-81832715 CCGCCCAGTGAGTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1152703749 17:81832722-81832744 GAGGCCCCGTTCTCCCCGTTAGG 0: 1
1: 0
2: 1
3: 1
4: 58
1152703741_1152703758 26 Left 1152703741 17:81832693-81832715 CCGCCCAGTGAGTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1152703758 17:81832742-81832764 AGGCCCAGCATCACCGCCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 103
1152703741_1152703757 25 Left 1152703741 17:81832693-81832715 CCGCCCAGTGAGTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1152703757 17:81832741-81832763 TAGGCCCAGCATCACCGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 110
1152703741_1152703756 24 Left 1152703741 17:81832693-81832715 CCGCCCAGTGAGTGCCTAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1152703756 17:81832740-81832762 TTAGGCCCAGCATCACCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152703741 Original CRISPR CCTTCTAGGCACTCACTGGG CGG (reversed) Intronic
900685101 1:3943256-3943278 CCTCCGAGGCAGTCACTGGTGGG + Intergenic
902884119 1:19392880-19392902 GCTTGCAGGCCCTCACTGGGAGG - Intronic
905451819 1:38061960-38061982 CTTTCTAGCCTGTCACTGGGTGG - Intergenic
906165639 1:43684157-43684179 CCCTCAAGACACTCACAGGGTGG + Intronic
913148530 1:116016715-116016737 CATTTTAGCCACTCTCTGGGTGG - Intronic
921076811 1:211706533-211706555 CCTTCTAAGAATTCCCTGGGAGG + Intergenic
922598128 1:226829356-226829378 CATTCCAGGCACTCTCTGAGGGG + Intergenic
1063231903 10:4073649-4073671 CATTTTAGGTACTCAATGGGAGG - Intergenic
1067010275 10:42705149-42705171 GGTTTTAGGCACTCACTGGGGGG - Intergenic
1075212622 10:120503724-120503746 CCTTCTATGCACCCTCAGGGTGG - Intronic
1077696143 11:4394203-4394225 CCTTCTCACCACTCACTGGTGGG - Intergenic
1079295539 11:19229897-19229919 CCATCTCAGCATTCACTGGGGGG + Exonic
1079398811 11:20088683-20088705 CCTTCTTGGCACTCACGTTGTGG - Intronic
1082268490 11:50144420-50144442 CCTTCTAGTCTCCCACTTGGGGG + Intergenic
1083309459 11:61776982-61777004 CCTGCTAGGCACTGGCTGTGTGG + Intronic
1084087494 11:66861257-66861279 GCTTCTAGGCACTGGCTGGGGGG + Intronic
1085311645 11:75520460-75520482 ACTGCTAGGCACTCAGAGGGAGG + Intronic
1085469896 11:76750983-76751005 CCATCTAGGCCCTCATTGGCAGG + Intergenic
1086912909 11:92493568-92493590 CCTTCTAGGCCTCAACTGGGAGG + Intronic
1087496427 11:98895560-98895582 CCATCAAGGCACTCTGTGGGAGG + Intergenic
1089709695 11:120306164-120306186 GCCTCTAGGGTCTCACTGGGAGG + Intronic
1091262622 11:134246144-134246166 CCTTCTGGCCACTCACTGCTGGG + Exonic
1092089509 12:5792956-5792978 CCTTCTTGGGACTCACTGGTGGG - Intronic
1093471944 12:19511569-19511591 CCTTCTGGGCACTGAGTGGGAGG + Intronic
1095591136 12:43905354-43905376 TTTTCTAGGCACTCAGTGGGAGG + Intronic
1102146963 12:110661434-110661456 CCTTCTAGGCAGTCACCCGCAGG - Exonic
1105245394 13:18645602-18645624 CATTCCAGGCTCTCTCTGGGAGG - Intergenic
1105896640 13:24722019-24722041 CATGCTAGGCACTCACTGCAGGG + Intergenic
1113271418 13:108678956-108678978 CTTACTAGGTACTCACAGGGTGG + Intronic
1119376853 14:74201619-74201641 CCTTCTAGGAACTCAAAGGCAGG - Intergenic
1121850211 14:97214822-97214844 CCTACTAAGCACTCAATGAGAGG + Intergenic
1122022784 14:98853219-98853241 CCATCCAGGCACTGACTGAGGGG + Intergenic
1122765226 14:104064524-104064546 CCTGCCAGGCACTGACTGGCAGG + Intergenic
1124030263 15:26004216-26004238 CCTTCTAGGCAATCACTGCCAGG - Intergenic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1126670354 15:51110466-51110488 CCTTCTAGGCACTCAAACTGGGG - Intergenic
1128802164 15:70503891-70503913 TCTTCTACGCTCTCCCTGGGCGG - Intergenic
1129450425 15:75648258-75648280 ACTTCTAGCCACTCGCTGAGTGG - Exonic
1130658507 15:85810845-85810867 CGTTTCAGGCATTCACTGGGGGG + Intergenic
1132011404 15:98279717-98279739 CCTGGTAGGCAATGACTGGGGGG + Intergenic
1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG + Intergenic
1133747610 16:8699190-8699212 CCTAGTAGTCCCTCACTGGGAGG - Intronic
1136071060 16:27787400-27787422 CCTTCTGGGCACCTCCTGGGCGG - Intergenic
1137540954 16:49361269-49361291 CCTTCTAGGCTCTCATTACGTGG - Intergenic
1137609943 16:49811446-49811468 CCTGCTAAGCACACTCTGGGTGG - Intronic
1140403564 16:74691912-74691934 CCTTCCAGGAGCTCACGGGGTGG - Intronic
1140681402 16:77388663-77388685 CCCACTAGTCACTCACTGTGTGG - Intronic
1144740131 17:17577106-17577128 CCCTCTGGGAACACACTGGGAGG + Intronic
1147255370 17:39177968-39177990 GGATCTAGGCACTCACAGGGGGG + Exonic
1148647923 17:49230037-49230059 ACCTCTGGGCACTCCCTGGGTGG + Intronic
1152703741 17:81832693-81832715 CCTTCTAGGCACTCACTGGGCGG - Intronic
1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG + Intronic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1167814771 19:51870025-51870047 CCTTCTGGTCCCTCCCTGGGAGG + Intronic
925283756 2:2702789-2702811 CCTTCAAGGCGCTCACAGCGGGG - Intergenic
927455618 2:23246810-23246832 CCTGCTTGGTACTCACTGAGTGG - Intergenic
930060786 2:47286779-47286801 CCTTATAAGAACTGACTGGGTGG - Intergenic
930503675 2:52255590-52255612 CCTACTAGGGACTCTCTGTGGGG + Intergenic
937157582 2:119731888-119731910 CCTTGTTGGCTGTCACTGGGGGG - Intergenic
938616267 2:133002235-133002257 GGTTTTAGGCATTCACTGGGGGG - Intronic
938776254 2:134544117-134544139 CCAGCTTGACACTCACTGGGGGG - Intronic
939100581 2:137890721-137890743 CATTCCAGGCTCTCTCTGGGAGG - Intergenic
939660835 2:144887596-144887618 CCTGCTGGGCACCCACAGGGAGG - Intergenic
940965472 2:159832456-159832478 CCTTTTTGGCACTGACAGGGAGG - Intronic
942966607 2:181901594-181901616 CCTTCTCTACATTCACTGGGTGG - Intronic
948241992 2:236445903-236445925 CCTTCTAGCCACCCACGGGAGGG - Intronic
948627054 2:239275792-239275814 CCTTCCAGGAGCTCACAGGGAGG + Intronic
948690623 2:239701200-239701222 ACTGCCAGGCACTCACGGGGAGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172900774 20:38333030-38333052 CTTACAAGGCACTCACTTGGTGG - Intronic
1174209678 20:48867403-48867425 TCTTCTAGACATTCCCTGGGGGG - Intergenic
1175138730 20:56843880-56843902 CCTTCCAGGCACCAAATGGGTGG - Intergenic
1176452539 21:6876893-6876915 CATTCCAGGCTCTCTCTGGGAGG - Intergenic
1176830712 21:13741942-13741964 CATTCCAGGCTCTCTCTGGGAGG - Intergenic
952056192 3:29450056-29450078 CCTTCTTGGCACTAGCTTGGGGG - Intronic
952273959 3:31859341-31859363 ACTTCTACGCCCTCCCTGGGCGG - Intronic
953256671 3:41297271-41297293 GCTTCTCTGCAATCACTGGGCGG + Intronic
960977906 3:123194282-123194304 CCTTTAAGGCACTCACAGGATGG - Intronic
961047106 3:123716645-123716667 GCTTCCAGGCCCGCACTGGGAGG - Intronic
961182307 3:124886800-124886822 CCTTCGGGGCACTCCCTGGTGGG - Intronic
966885905 3:184378059-184378081 CCTGCTGGCCACTCACCGGGTGG + Exonic
970616889 4:17776131-17776153 CCTGGTAGGCACTCACTATGTGG - Intronic
970855869 4:20648971-20648993 ACTTCTAGGCACTCCCCGGATGG + Intergenic
972629268 4:40829293-40829315 TCTTCTGGGCACTCTCTGGTTGG - Intronic
972710802 4:41592616-41592638 CCTTCTGGGCACTCATTGTCTGG - Intronic
975582598 4:75920467-75920489 TCTGCTAGTGACTCACTGGGTGG - Intronic
984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG + Intergenic
988449035 5:31321166-31321188 AGTTCTAGGCACTGAGTGGGTGG - Intronic
988472869 5:31557061-31557083 CATTCTGGTCACTCACTAGGAGG + Intergenic
988555875 5:32235656-32235678 TCTTCTGGGCCCTCACTGCGGGG - Intronic
990051212 5:51503966-51503988 CTTACCAGGCACTCACAGGGAGG - Intergenic
990961130 5:61394529-61394551 TCTTCTTGGGGCTCACTGGGTGG + Intronic
994880448 5:105486880-105486902 CCCTCTACCCATTCACTGGGAGG + Intergenic
997218816 5:132139851-132139873 CCTTCTAGACACTGACTAGAAGG + Intergenic
997369721 5:133350796-133350818 CCTTCCAGGCAGTGACAGGGAGG + Intronic
999467716 5:151823021-151823043 CCTGCAAGGCACTCCCTTGGGGG + Intronic
1004425997 6:15507495-15507517 CCTTCTAAGCACTGCCGGGGAGG + Intronic
1006975341 6:38095630-38095652 TCTTTTAGGCACTAACTTGGGGG - Intronic
1008735609 6:54540031-54540053 CCTTCTAGTCACTAACGGGTTGG - Intergenic
1008854471 6:56065424-56065446 CCTTCAAGTCACTCACTGTGTGG + Intronic
1015163500 6:130178359-130178381 CCTTCCCCGCACTCACTGTGGGG - Intronic
1018063456 6:160108565-160108587 CCTGCGAGGCTCTCTCTGGGAGG + Intronic
1019075733 6:169386886-169386908 CCTTCTAGAAACTCCCTGTGCGG + Intergenic
1024987613 7:55208980-55209002 TCTACTTGGCACTCGCTGGGGGG + Exonic
1032752208 7:134852589-134852611 CCTTCTAGGCAGTCATTGAATGG + Intronic
1033156463 7:138961139-138961161 TCCTCTAGGCACACACTGGGAGG + Intronic
1033282667 7:140017212-140017234 CCTCCTGGGCCCTCCCTGGGGGG - Intronic
1034276988 7:149828193-149828215 CCGGCTAGGCACTCACAGGCTGG + Intergenic
1035232742 7:157476266-157476288 CCTGCCAGGCACTCAGTGGCTGG - Intergenic
1036382921 8:8250380-8250402 CCTTCTAGGCACTGAATTTGAGG + Intergenic
1037603642 8:20419706-20419728 CCTTCTATGCACACAGTGTGTGG - Intergenic
1038572658 8:28676219-28676241 CCTTCTAGACCCTCCCAGGGTGG - Intronic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1040806627 8:51403641-51403663 CCTTCTTGGCACTCACAGCCAGG + Intronic
1043983934 8:86671831-86671853 CAGACTAGGCTCTCACTGGGAGG - Intronic
1048342795 8:133553890-133553912 CCTTCTGGACCCTCACTGTGAGG - Intronic
1049473483 8:142786562-142786584 CCTTATAGGCACGGGCTGGGCGG + Exonic
1055467651 9:76581773-76581795 CCTTCTGGGTACTCAGAGGGTGG - Intergenic
1056253453 9:84774165-84774187 ACTGCTGGGCAGTCACTGGGAGG + Intronic
1062400401 9:136370209-136370231 CCTTCCAGGCACGGAGTGGGCGG + Intronic
1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG + Exonic
1203516642 Un_GL000213v1:7622-7644 CATTCCAGGCTCTCTCTGGGAGG + Intergenic
1186530483 X:10290465-10290487 CCTCCTTTGCTCTCACTGGGAGG + Intergenic
1194436271 X:93871894-93871916 CCTTTTATGCACGCACTGAGAGG + Intergenic