ID: 1152705544

View in Genome Browser
Species Human (GRCh38)
Location 17:81841692-81841714
Sequence TGCAGCCAGCCCGCAAGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152705536_1152705544 26 Left 1152705536 17:81841643-81841665 CCCCGGCGAGGCCTGGTCTGGCT No data
Right 1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG No data
1152705535_1152705544 27 Left 1152705535 17:81841642-81841664 CCCCCGGCGAGGCCTGGTCTGGC No data
Right 1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG No data
1152705541_1152705544 -3 Left 1152705541 17:81841672-81841694 CCGTCTCTGGCTCCAGCAGCTGC No data
Right 1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG No data
1152705539_1152705544 15 Left 1152705539 17:81841654-81841676 CCTGGTCTGGCTTGAGAGCCGTC No data
Right 1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG No data
1152705537_1152705544 25 Left 1152705537 17:81841644-81841666 CCCGGCGAGGCCTGGTCTGGCTT No data
Right 1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG No data
1152705538_1152705544 24 Left 1152705538 17:81841645-81841667 CCGGCGAGGCCTGGTCTGGCTTG No data
Right 1152705544 17:81841692-81841714 TGCAGCCAGCCCGCAAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152705544 Original CRISPR TGCAGCCAGCCCGCAAGCTC GGG Intergenic
No off target data available for this crispr