ID: 1152713807

View in Genome Browser
Species Human (GRCh38)
Location 17:81888555-81888577
Sequence CGTGACAAGCTGAATGTTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152713800_1152713807 25 Left 1152713800 17:81888507-81888529 CCCCGGAAGTCACCTCTGTGCAG 0: 1
1: 0
2: 2
3: 12
4: 132
Right 1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG 0: 1
1: 0
2: 0
3: 5
4: 81
1152713804_1152713807 13 Left 1152713804 17:81888519-81888541 CCTCTGTGCAGGCCTCCGCTGTG 0: 1
1: 0
2: 1
3: 17
4: 228
Right 1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG 0: 1
1: 0
2: 0
3: 5
4: 81
1152713805_1152713807 1 Left 1152713805 17:81888531-81888553 CCTCCGCTGTGCGTCAATCTGTG 0: 1
1: 0
2: 1
3: 4
4: 42
Right 1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG 0: 1
1: 0
2: 0
3: 5
4: 81
1152713806_1152713807 -2 Left 1152713806 17:81888534-81888556 CCGCTGTGCGTCAATCTGTGACG 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG 0: 1
1: 0
2: 0
3: 5
4: 81
1152713801_1152713807 24 Left 1152713801 17:81888508-81888530 CCCGGAAGTCACCTCTGTGCAGG 0: 1
1: 0
2: 1
3: 28
4: 201
Right 1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG 0: 1
1: 0
2: 0
3: 5
4: 81
1152713803_1152713807 23 Left 1152713803 17:81888509-81888531 CCGGAAGTCACCTCTGTGCAGGC 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152713807 Original CRISPR CGTGACAAGCTGAATGTTCA TGG Exonic
903305488 1:22410038-22410060 CATCACTAGCTCAATGTTCAAGG + Intergenic
903508594 1:23856311-23856333 CTTGACAGGCTGAGTGTACAGGG - Intronic
916407439 1:164511200-164511222 CATGACCAGCTGAATCTTCAAGG + Intergenic
916407927 1:164515850-164515872 CGTGACCAGCTCAATCTTCAAGG - Intergenic
919597895 1:199587299-199587321 AGTGAAAAGCTGAAAGTTCTTGG - Intergenic
920562706 1:206950284-206950306 CATGACAAGCTCAAGGTCCAGGG + Intergenic
920758885 1:208762529-208762551 GGTGACATACTGAATGGTCAAGG - Intergenic
1064038629 10:11937659-11937681 AGGGACGAGCTGAATGTTCCAGG + Intronic
1064583989 10:16821349-16821371 CCTGAGTAGCTGAATTTTCAAGG + Intergenic
1068851126 10:61742239-61742261 CATGACAAGCTTAATGTCCCCGG - Intronic
1071757970 10:88566833-88566855 AGAGAAGAGCTGAATGTTCAAGG + Intronic
1083995899 11:66272143-66272165 CGTGTCATCCTGAAAGTTCAGGG - Exonic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087936033 11:104035837-104035859 GGAGACAAGCTGGATGTTGAAGG - Intronic
1088409168 11:109514305-109514327 CATGGCAAGCTGAAACTTCAGGG - Intergenic
1089143648 11:116308419-116308441 CGTGGCCAGATGAAAGTTCATGG + Intergenic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1099816621 12:87657017-87657039 TGTGACAAGTAGAATGTTTAGGG - Intergenic
1107402553 13:40083555-40083577 TGTGAAAATCTGGATGTTCATGG + Intergenic
1110437550 13:75492326-75492348 CTTTACAATCTGAATATTCATGG - Intergenic
1115644937 14:35362485-35362507 CGTGGGAAGCTGAATGTGCTAGG - Intergenic
1116169459 14:41381217-41381239 CGTGCCAATCAGAATGTGCAAGG - Intergenic
1124377169 15:29135689-29135711 CGTGACAGGCAGTATGTTCGTGG - Intronic
1130764868 15:86859629-86859651 CGTGACAAGCCGTGTGTTCTCGG - Intronic
1131808029 15:96143355-96143377 CATGACTAGCTGAATGTCTATGG - Intergenic
1131864680 15:96694913-96694935 CATAACATGCTGAAGGTTCACGG + Intergenic
1135491166 16:22910974-22910996 GGTGACTAGCTGCATGTTAAGGG + Intronic
1139348216 16:66318204-66318226 CATGATAAGCTGGATGCTCAAGG + Intergenic
1141914561 16:87086251-87086273 CGTGCCAAGCAGAATGCTCCTGG - Intronic
1143967860 17:10769817-10769839 CAAGACAAGGTGAAAGTTCAGGG - Intergenic
1146659912 17:34658871-34658893 AGAGACAAGCTGAAGGCTCAGGG + Intergenic
1148398042 17:47325593-47325615 CGAGGCAAGAAGAATGTTCAAGG - Intronic
1152713807 17:81888555-81888577 CGTGACAAGCTGAATGTTCATGG + Exonic
1152715495 17:81898405-81898427 GGAGACATGCTGAGTGTTCAGGG - Intronic
1157482195 18:48062435-48062457 CTTGACACGCTTAGTGTTCAGGG - Intronic
1159193516 18:65080938-65080960 CCTTAGAAGCTGAATGTTCTAGG - Intergenic
1160562253 18:79765948-79765970 TGTCACGAGCTGACTGTTCACGG - Intergenic
1161524004 19:4742432-4742454 CGTGACCATCTGAAAGTGCACGG + Intergenic
1164366581 19:27589790-27589812 GGTGAAAAACCGAATGTTCACGG + Intergenic
931813723 2:65879809-65879831 GGTGACAACCTGAATTTTAATGG + Intergenic
938746150 2:134280329-134280351 TGAGACTTGCTGAATGTTCAAGG - Intronic
1169871072 20:10249025-10249047 CTTGACAAGCTGTGTGTCCATGG - Intronic
1169897217 20:10517294-10517316 CTTGACAAGGTGAAAATTCAGGG + Intronic
1179914818 21:44469685-44469707 AGTGGCAAGCACAATGTTCATGG + Intergenic
1182844038 22:33416157-33416179 CTTGACTAGCTGAATGGTCTTGG - Intronic
949324173 3:2844889-2844911 TGTGGCAAGCTGAAGGTTCATGG + Intronic
953465351 3:43114919-43114941 CGTCCCATGCTGTATGTTCATGG + Intergenic
953687150 3:45086982-45087004 CGTTACAAGCTGAAGGTACCAGG - Intronic
954776770 3:53026547-53026569 CCTACCAAGCTGCATGTTCATGG + Intronic
957713576 3:83895777-83895799 CCTGAAAAGCAGAATGTTCTAGG + Intergenic
963986011 3:151595626-151595648 CGTGACAACATGAATGAACATGG + Intergenic
964804881 3:160598012-160598034 CCTGCCAAGCTGAATTTTCTTGG - Intergenic
974634317 4:64539679-64539701 CTTGACAAGTTTAATTTTCATGG - Intergenic
974687810 4:65253364-65253386 CATTACCAGCTGAAAGTTCAGGG - Intergenic
983776434 4:171613251-171613273 CTAGAGAAGCTGAATGTTCTAGG + Intergenic
986498001 5:8366217-8366239 CCTCCCAAGCTGAATGCTCAGGG - Intergenic
987517183 5:18926045-18926067 CTTGACAAACTGAATATTGAGGG - Intergenic
989346067 5:40430715-40430737 CATGACAACCTGAGTTTTCAGGG + Intergenic
990179921 5:53149315-53149337 ACTGACCAACTGAATGTTCAGGG - Intergenic
990289406 5:54333428-54333450 CATGACATGCTGTATGTTTATGG - Intergenic
990380587 5:55218876-55218898 CATGACAAGCTGATTGTTTTGGG + Intergenic
995512362 5:112921939-112921961 CGGGACAAGCAGCATATTCAGGG - Intronic
995887599 5:116913731-116913753 CAAGACAAGCTGAATGGTCAGGG - Intergenic
1000473715 5:161678624-161678646 AGTGTCCTGCTGAATGTTCATGG + Intronic
1008794242 6:55281512-55281534 AATGAGAAGATGAATGTTCACGG - Intronic
1011745889 6:90407357-90407379 GGTGATAAGCGGAATGTTCTGGG - Intergenic
1016432094 6:143996508-143996530 CGTGACAACCTTTATCTTCAAGG - Intronic
1025983562 7:66428082-66428104 GGTGACAAGACGAATGGTCACGG - Intergenic
1028349429 7:89826968-89826990 CGTGACAAGCTGAACATTTTAGG + Intergenic
1029316908 7:99723969-99723991 TGTGCCAAGGTGAATGATCAAGG - Intronic
1030442651 7:109607294-109607316 ATGGACAAGCTAAATGTTCAAGG + Intergenic
1034418518 7:150977560-150977582 TGTGACACGCTGAGTGTGCAGGG - Intronic
1036617126 8:10396952-10396974 AGCGACACTCTGAATGTTCACGG - Intronic
1040347378 8:46519354-46519376 AGTGAAAAGCTGAATATTCCTGG + Intergenic
1042035281 8:64526268-64526290 CATGGTATGCTGAATGTTCAGGG - Intergenic
1043392196 8:79802584-79802606 CTTGACTAGCAGAGTGTTCATGG - Intergenic
1048203858 8:132400106-132400128 GGTGAAGAGCTGCATGTTCAGGG + Intronic
1052283946 9:26763258-26763280 TGTGAGAAGCTGAATGATCTCGG - Intergenic
1052471442 9:28900657-28900679 CTGGACAAGCTGAATGATAAAGG + Intergenic
1053876574 9:42551907-42551929 CGGGAGATGGTGAATGTTCAGGG + Intergenic
1054235124 9:62549814-62549836 CGGGAGATGGTGAATGTTCAGGG - Intergenic
1055437080 9:76302457-76302479 CGTGACGAGCTAAATGGTCATGG + Intronic
1058813550 9:108663837-108663859 CTTAACAAGCTGAATGCTGAAGG + Intergenic
1058987400 9:110220950-110220972 TGTGACAAGTTCAAAGTTCAAGG - Intergenic
1188864405 X:35297275-35297297 TTTGAAAAGCTGAATGTTTATGG - Intergenic
1192092969 X:68180613-68180635 CTTCACAAACTGTATGTTCATGG - Intronic
1195828538 X:109029629-109029651 CTAGACAAGCTGACTGTTGAGGG + Intergenic