ID: 1152713983

View in Genome Browser
Species Human (GRCh38)
Location 17:81889498-81889520
Sequence CCCTCAGACCCAGGTGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 299}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152713983_1152713988 -6 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713988 17:81889515-81889537 TGAGGGCTCCTGCCATTGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 188
1152713983_1152713993 26 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713993 17:81889547-81889569 GTGTACCACGATGCAGGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1152713983_1152713992 20 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713992 17:81889541-81889563 TGACACGTGTACCACGATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 33
1152713983_1152713986 -8 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713986 17:81889513-81889535 TCTGAGGGCTCCTGCCATTGTGG 0: 1
1: 0
2: 1
3: 17
4: 273
1152713983_1152713987 -7 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713987 17:81889514-81889536 CTGAGGGCTCCTGCCATTGTGGG 0: 1
1: 0
2: 3
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152713983 Original CRISPR CCCTCAGACCCAGGTGCTCT TGG (reversed) Intronic