ID: 1152713986 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:81889513-81889535 |
Sequence | TCTGAGGGCTCCTGCCATTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 292 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 17, 4: 273} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1152713983_1152713986 | -8 | Left | 1152713983 | 17:81889498-81889520 | CCAAGAGCACCTGGGTCTGAGGG | 0: 1 1: 0 2: 5 3: 24 4: 299 |
||
Right | 1152713986 | 17:81889513-81889535 | TCTGAGGGCTCCTGCCATTGTGG | 0: 1 1: 0 2: 1 3: 17 4: 273 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1152713986 | Original CRISPR | TCTGAGGGCTCCTGCCATTG TGG | Intronic | ||