ID: 1152713986

View in Genome Browser
Species Human (GRCh38)
Location 17:81889513-81889535
Sequence TCTGAGGGCTCCTGCCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152713983_1152713986 -8 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713986 17:81889513-81889535 TCTGAGGGCTCCTGCCATTGTGG 0: 1
1: 0
2: 1
3: 17
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152713986 Original CRISPR TCTGAGGGCTCCTGCCATTG TGG Intronic